Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3741
Length(NT) : 963
Best Gene Model Blast : Link to GSTUMT00008227001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3741
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCCAGCAGCAACAGCAGAC
CCCAGACATCCACCCCTTCTACCAGCATCAACACTCAGCTCTTCACATTC
CGCCTGATCAACAGCCGGGAAGGACTCTTTCACCCGGTGAGGAGTCATAC
GTAACCAACAACTCTGCGGTGCGCTCGCGCGAGTCTGGATCCGTGACAGA
ATCGCAGCAGTCGGAAGCAGGTGAAGGAGATGGCGGGTGGGAATACGACT
CGCAGGGAAACCCCACACCTGTCTCGTACCAACGTCGTGAGCCCAGTCGC
GCGGAAGAAGAGGAGGAGAGTTGGGATACTTATCCCACGTATGATGGAAA
CGACTACGAATCGAACGGTGGAGGCAGTGGCGGAGGAGTAGCAGTTGGCT
ATGGAAGAGGCTGGGAGGGCGTTTCAAGGGCTCATCACCATCCTACGAGA
TTGAGTGACGTTCCGGAGGAGGACGAGGAGAGGAGAACCCACCTCGGTAG
CGAAGGCGGCCGGATTTCGAGGTAGCTTTTGTGAGGAGCGTGCTCAAGTC
ACAAAAAGGGGACGTTATGAGAGAGTGTATGTTCGAAGGGAGGGCTGGGG
GGTGACGATTGGAATGAGGAAGTCTAATACTGCGTTATGTCTTCCATCTT
TCCCTTCATTCCTATGGTTGTGTTTTTTCCAGCTAAACCACGTTGGTGAA
ACTTCATTTGCGTGTTATTATATTCCCACGAGAGGGGTTTCCTTTTTTTT
TTATTACTATGATACTGATCATTTGTTTCCCGTTCATGTCGGACTGGCTA
AGGGTGGGGACAGGGACGGGCGGGGTGGTGGTGGTGCAGCTGCTTGGTAT
CTTTTGCCTATCTCATCCTTTTTCCCCTGTACTTGATCAACTCCAATCGA
ATCAAAAATTTCCAAATCTAATTTCTCCTTTTTTCGTTTTCGTTTTTTTC
CATCTCGTCTGTT

Sequences in the Contig:

SY0AAB42YE17FM1 SY0AAC15YB21FM1 SY0AAC45YF02FM1
SY0AAD41YF22FM1