Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3740
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00010106001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_06410
Accession: ref|XP_369895.1| Score: 349 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: fgr:FG05411.1 Score: 349 E_value: 8e-32
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2937 Score: 239 E_value: 3e-21
PFAM Definition: DCP2, Dcp2, box A domain. This domain is always found to the amino terminal side of pfam00293. This domain is specific to mRNA decapping protein 2 and this region has been termed Box A. Removal of the cap structure is catalysed by the Dcp1-Dcp2 complex..
Pfam Number: pfam05026 Score: 280 E_value: 4e-26
Swissprot: Q75BK1|DCP2_ASHGO

Sequence:
>Contig3740
TTGGACCATATCGTCAACTCCACCTTCAACTAACTCTACCCAGACCACTA
CGCTACTTAGTGTTCAGCTCTCGACTGCGTCTAGTGTACCGATACCGTGC
AGTTTTTTTTTCTTTTTTTCTTTGTTGTTTTTTCCTTCTTTTCTTTTCTT
TCGCTCGCTTCTCCCTTTGCGGGACTGACAAGCTTTTCTATTTCGCCCTC
TGGCGCCCGCGGGCTAGCCCCGAATCCCGTGGTCTAGGGGTCTACGAGCG
AGAGACCATGGATCTTACCAATTCTTATATTTTTAGTAACTCGACGCTGG
CCGAAATTCTAGATGACCTTTGTGTGAGATTCATCATCAATCTACCAGAG
GAGGAGCTGAGTTCGATTGAGCGAATATGTTTTCAAATCGAGGAGGCGCA
GTGGTATTTCGAGGATTTCATCCGAGAAACGAATCCCATGCTGCCTACAC
TTCCGCTCCGTACTTTTCTTAATAAGATCTTTGCTATCTGTCCGCTACCT
ATCTTGAAGGAAATGCCGCCTGAACGAGCGGAAAATGCGTTTGCGGAATT
CATGGCTTACAAAACACGCGTGCCAGTTCGTGGTGCAGTATTGTTGAACA
GTGCGATGGATAAGTGTGTACTTG

Sequences in the Contig:

SY0AAC15YA24FM1 SY0AAD61YG06FM1