Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig374
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00006197001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541436.1| Score: 326 E_value: 1e-28
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03582 Score: 282 E_value: 6e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O14212|YDT7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig374
TTGGCATCTCTTCTCCCCCCCCCCGCTCTGGCGCAAAAAAAACCATCACG
AACAAGATGAAGTTTGCCCATTCGTTCTCCCAAGTTCTACAGGAGGAGGA
CTTCCCCGCTGATTGGCAAGCGGCCGCGATAAGGTATCGTCAGCTGAAAA
AGTGTATTAAGAAAGTACAATTAGAATTGTTGGATTTGGGACTCACTGTG
GAGGTGTTAAAGGGGTTGGCGGAGGAAAGGGAAAGTCCAAGTTTTGAATA
TATGTTTGATGGTACGGTACATAGTTTTCAACCAAAGTTAGTGTTGACGA
TTGATGCTGTCGACCTGATTCCACTCGATTTGAACCTTTCGGAGGACACC
CGGCGGTCATTAGAGTGCCTAGTCAAGAAAAAGCTAGGGAGGGAAGAAGT
GGAGACTAAGGACGCTGCTGTAGAAGGTAGTACGGAGATGTGCAAAAGCA
TTCGGACCATTGAGATAACCCTCTGTTCGGATTCCGAGTTCTTCCATCTC
CTCACCTCCGAAATAACTTCGCTGGAGGCTCTTCAATCCCGATCTGGGTC
CGAGGTTCGCTCTCACATCCTGCAACTCGGCCAGTCCGTCACCGCTGTTG
CTGCGCCAAAATCTCGAAATAATAAATCAGACCTCTACCCATGGCGCGAG
ATATTTAGGATATACCTCGAGACTGGAATATTTTTTTCGAATCTTGAG

Sequences in the Contig:

SY0AAA22YE12FM1 SY0AAA32YP20FM1