Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3739
Length(NT) : 1264
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3739
CAAGGATTGCTTTATCTATCTTAACAGATCGCATATTCTCAGACCACTTT
GTCTTAAACCATATTCCTTTCTAGGAGTCTCACAACTCCAGCTGCACTTC
CATATCGAGCACATATTTCCTTTCGTTTGACGATCGTTTTTAGAGTAGAA
ATGTTTGCGAGACACAATGGAACGGTCGTATCGGAACGGACACCAAACCA
CAAAGTTGAGTTGGGCCACAACCTTGGCACGGGTAAAGGAGGCGGATGAG
GAAATTGTGACGCTTATTAGTCCCACCCAACGCCTCAAGTTCTGGGAAAG
ATACGTTTGACATAACAGATCTACTTAGCTAGAGTCAAATTGCCTGACAG
AATATGGACAAATCTCTGGCGGACATGAAATCGATTCTGAGGTTCATCGA
TGCAGCTTATCTTAGGCTTGCCCTTGGGTAGTGTATATTGTAGTAGCAAG
GGGGGTTCTGCTAGCGCAGGCGGAAGCATGGAATTGGTCCTTAATAAAAT
ATACAATACTTAGGGGCTATACCCCCGTATAGGGCAAGCTTCGGAATACC
GATAGAATCTTAATGGGCAAGGAAACGCATATGAATATGAGAATGATGAA
CGGAAAAGAAAGACAAAATACATGGCCCATTATAGAGGGAAAGTCGGCGA
AAAACTTATATAGGTGTGGAAGAGAAAAACACTCGAAACATCATGAGACG
AAAAGAGATCCACCATACTTCCTGGGATCAAGCACTGCTAACATGAATTC
AGTGTAGATATCCAGTATATAATCCTCTCCGTTTCATCCCTAAACAAAAA
TGTGTTTGCACAACTCAATATCAAAAAGGTTGTCTGTTTTCCAGACACCG
AAGGTTGCGGATGAGTCGCCGAAACTCTAGTCCAGCCATAGTTTGTTTCA
ACACGTGATTGGCCCCCCTTTCCAGCGGGAGTCCTGCCCCCTACCATTAT
TTCACCCCTAGCTCTTTTGCCGATTCCAAGGGCTTCATCGATATCCCGAG
GTCTTTCCGGATAATCTGGGAGTATCCTCTCATCCCTCATCCAGTATCCC
TTTCGTGGGTGACAGATTTACTTCTGCAAATGTAGGAGAGCTCGGGTTGA
CCTTAGGTGAATTATAAAATGTGGGTGTATCACGTGAGGCCTGTCGCCCC
TTACCGGTATATAATTGGGGGGTGCCTTTGGCTTTGGAGGAAGTTTTCCT
AACGCTTCTACCCTTCGCAACGTTAATTTTTCCTTCTTTAATTTTTCCTT
ACTGCATCCATCAA

Sequences in the Contig:

SY0AAC15YA23FM1 SY0AAC7YN05FM1 SY0AAD38YC05FM1
SY0AAD61YJ13FM1