Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3737
Length(NT) : 808
Best Gene Model Blast : Link to GSTUMT00005255001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001265989.1| Score: 236 E_value: 4e-18
KEGG Definition: Sad1/UNC domain protein
Accession: afm:AFUA_5G06480 Score: 229 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3737
CCCGTTGAGAGAGAGAGAGGTAACTTAGAGAGGATGTTACAGTTCTCGGC
AACAGCGACAACGACGACAGCGACAACGACCACGACAACGCTGCTCGCTT
TGCTACTACTGCCACTATTATGCTTAACAGTGACGGCATCGACGGCGTCG
ACATGTCGGGCCGTCACGGCGAATTATATCACGCATCGGTTACCGCAACA
GTGTTTGAGAAATGGGAGTGGGAGTAGTGGGGGGAATTACACTGCTACGC
CTAGTTCTAGTTTTGAGCAAGTGGTTGCTTCTATAACTGTGGTTACGGCG
GGGGTAGGTGGTGAAGCCGAGGGGGGAACTCAAACAGCGATAGAAGCTTC
TAGACCTACACAAGCTCCTTCGGCAAGTTCAACAATTTCCTCCGAGAATG
CACCGACGGACACTGCAATCCTACCACCACCACCTCCTCCTCCACCGCCA
CCGCTGGGGGCTACCGGAGATGAAGGCGAGGATTCTCCCCTCGACACGGC
CAAGTTCCTCTCCTTCGAGGAATGGAAAGCACAGAACCTGGCCCGTGCTG
GACAGAGCTCTGAGAGCTTTGAGGATCGGGTGCGGGAGCCCCGGCGCGGT
GGCGCTAGCGGTTCCCTGAACAACGCTTTGGATTCTCTGGGCGAGGACGC
TGAGATCGAGTTTGACTTTGGTGGTGAACCTGATGGTGGAGTGCCTGAGT
ATGGGGTTGGCCGCTCGGACGGGCCCAATTCAGCGACGGCCGGTGGTGGT
GGAGGTGAAGACAGTCCAGACCCGCGCGGTCATACAAGGTCCAAGAATGC
AGGGACGA

Sequences in the Contig:

SY0AAB2YM24FM1 SY0AAC15YA14FM1