Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3736
Length(NT) : 714
Best Gene Model Blast : Link to GSTUMT00011649001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_06964
Accession: ref|XP_001243068.1| Score: 424 E_value: 4e-40
KEGG Definition: Sterol desaturase family
Accession: afm:AFUA_1G11140 Score: 400 E_value: 1e-37
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0873 Score: 142 E_value: 6e-10
PFAM Definition: No Hit Found

Sequence:
>Contig3736
TTGGCTGCATCCTCCAAACCATCTCGCTAAACTCAACTACCCACAGTGAC
AAAAACACTCAAAAATGCTACTAGACACCCTCCTCACCCTCTGCGGCCTA
ACCCTCCTCTTCACCCCCACCTCACCCTCCTGGAGCACAAGCTTAAACCT
CCTCTTCTTCTACATAACCTGGTCAACCCTTCTCCTAGCGCACCCACCGC
TGCGCGTGGAGCTCCTCGGAACACTGATCTCGCGATTCATATTCTTCTGG
CTGCCGGCCCTATTCTTCTACCTCCTGGACACGGCACTTCCCAGCATAAC
ATCAGAATGGAAGACCCACACCGGCACGAATGCGCAGTTTGACAGGCGGG
CTGGCAAGGTGGTCGCGGTGGCGATGGGAAATATGCTGCTAGGTGTAGGG
GCTCAAGGGGTTGTGGAGTGGACGCTTGTGGAGGTTGCGGGGTGGAATAG
CGCGGTTAGGGTTTCCAGTAGTATGCCATTGCCAGGCGGGGTGGTGTGGG
ATTTAGTGAGGGGACTGGTATTGAAGGAGGTTTTGCAATACTACCTCCAC
CGCTACTATCTCCACTCTGCTACCAGCCTCCACACCCGGTGGCAACATGC
GCCCCCAACCCCACCCCCGCTCTGGCCCGCACTAGCACACTACGACCATC
CACTGCCATACCTCATACACCGCTTCATACCGGTCTACGCCCCCGCCGCG
TTCCTTCATTTCCA

Sequences in the Contig:

SY0AAB5YM10FM1 SY0AAC15YA02FM1 SY0AAC53YP01FM1
SY0AAD16YO02FM1 SY0AAD29YO06FM1 SY0AAD60YG04FM1