Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3735
Length(NT) : 632
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3735
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCCCCTGTCCCGCACCGT
CTCCTCCCCTCACCCACCGGCAGACCTGCGAGCCCCATACTCGAGTCCAC
GTCCTCCTACCGTGAAAGGCGCGCAACGAACACACCAATCTCCACCCGGA
AACGCATTAAAAAACAGGCTCAACCCACACACGATCGGCAAGTATGTCAA
CCCTGGAACCCTCAGATACCAATGGAACTTCCGATCGCCCACGTCTTGAC
GCTCTCGAAGCAGATTTACAAGGCCTCACTACGGATGTGCAGGGCCTCAC
AACAGTCCTGGAGGGATTTTCGACAAGGGCCGCAGAGGATGCTGCGATGC
ATTGGGAACTGACTGGGGAGTTGAAAGCCAGACTCGATCATCAGGACCAG
ATGCTACAAACACTTGTTGACCGATCGGAGGCTCATGGCCAGCTGCTACA
AACACTTGTTGATCGATTAGGAGTTCAGGAAGCAGCGCACGAACCCGAGC
GGAGGCAATGATATCTCCCTGTGTCTACTTGTTTATTGTTTGTATGTTTC
TCGGGTGAGGAGCACGGCGGGTATCAATGACAGTGAGCGTGGTGGGTATG
GTGCCTGTGACGGGCATGGGCATGGGGATAAT

Sequences in the Contig:

SY0AAB6YJ08FM1 SY0AAB8YB20FM1 SY0AAC14YP22FM1
SY0AAC56YA06FM1 SY0AAD17YA05FM1 SY0AAD61YN23FM1