Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3733
Length(NT) : 1128
Best Gene Model Blast : Link to GSTUMT00007968001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_06856
Accession: ref|XP_001797217.1| Score: 434 E_value: 5e-77
KEGG Definition: PPN1, PHM5; Ppn1p [EC:3.6.1.10]; K06018
Accession: sce:YDR452W Score: 314 E_value: 5e-56
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3770 Score: 230 E_value: 8e-20
PFAM Definition: No Hit Found
Swissprot: Q04119|PPN1_YEAST
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane
GO:0000298 = Molecular function: endopolyphosphatase activity
GO:0006797 = Biological process: polyphosphate metabolic process

Sequence:
>Contig3733
TTGGATACCCCGTTCAGTTTGGTGAACGAGACCTTCGCCTGGATTAAGGA
AAATCTCAGAGATGAAATCGACTTTGTTATCTGGACTGGCGACTCTGCAA
GACACGACAACGATGTCAATATCCCACGTAGCGATAGTCAAATTTTCACG
TTGAACCGACGCATTACCCAGGGAATGGTCGACGTTTTTGGGAAGCCGGA
TAATCTTGGTGATGATGACCCGACAAATGACTTGGTTGTCCCAATGTAAG
CCTCAATCTTGCCATCTTTGGAACAGAGCTGGCTTCGGGTGGTATCTTTT
ACGACTTCTTGCGGTTTCTAAAATTGATGTTTAGTATTCCGACTCTTGGA
AATAACGATATCTTTCCTCACAATATTATGACGGACGGTCCCAATAAGAT
CACGCGTGAATTCTCGGACATCTGGAGGAATTTCATTCCGCAAGACCAAT
ATCACGTGTTTGACAAAGGAGCCTATTTTTGGACCCAAGTCGTACCGGGC
ACCAACGGCAAGATGGGTTTGGCTAGCAAAGGCGGCCTTTCAGTTATTTC
ACTCAACACTATCTATTTCTTCGGTTCCAACGCTGCTGTCGATGGCTGCG
ATCTCAAGGGCGAACCAGGTTATGAGCAAATGGAATGGTTGAAGATCCAA
TTACAATTGATGAGGGATATCGGGATGAAAGCCATTCTGATTGGCCACGT
TCCGCCGGCTTGGACAAGTACAAAGCAAAGTTGGGACGAAACGTAAGCAT
CCTCGATACCTGTACAATTTCTTTACTAAGCAACCTTGCAGGTGCTGGAA
GAAGTATGTTTTGTGGTCCAAGCAATACCGTGATGTTATCGTGGGGTCTA
TCTATGGCCATATGAATCTGGACCATTTTATGGTGCACGATAGTGACGAG
CTCAAGCCACCCCATGACGACAGCAAGCGGAAGAAGAAGAAGAAGAAGCC
CAAGAGGAAGTGGACCGGCCGCTCTGCTGAGGAGATGGTTGCTCCCGAGA
TGGACCCCTCGGAATTCGATGAGGAGAATCCGGTCTACAATGTTCAGAAC
GCAGAGTCATACCTCAATTCGTTGAGAGAGGCCTTTTCTTACCTTCCCAC
TCCTATCGGAGCTGTTGGCAAAAGCGAT

Sequences in the Contig:

SY0AAC14YP17FM1 SY0AAC15YF08FM1