Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3732
Length(NT) : 2185
Best Gene Model Blast : Link to GSTUMT00003670001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: predicted protein
Accession: aor:AO090701000780 Score: 133 E_value: 6e-06
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4157 Score: 120 E_value: 9e-07
PFAM Definition: TFIIA, Transcription factor IIA, alpha/beta subunit. Transcription initiation factor IIA (TFIIA) is a heterotrimer, the three subunits being known as alpha, beta, and gamma, in order of molecular weight. The N and C-terminal domains of the gamma subunit are represented in pfam02268 and pfam02751, respectively. This family represents the precursor that yields both the alpha and beta subunits. The TFIIA heterotrimer is an essential general transcription initiation factor for the expression of genes transcribed by RNA polymerase II. Together with TFIID, TFIIA binds to the promoter region; this is the first step in the formation of a pre-initiation complex (PIC). Binding of the rest of the transcription machinery follows this step. After initiation, the PIC does not completely dissociate from the promoter. Some components, including TFIIA, remain attached and re-initiate a subsequent round of transcription..
Pfam Number: pfam03153 Score: 119 E_value: 1e-06

Sequence:
>Contig3732
TTGGATGAAATCGATGCACGGCACCTACGTTAATGGCCTTCAGCTTGCCG
GAGATGAAACTGCAGAGTTGACGGATGGGACAGAGGTTACGTTTGGCTCA
GAGGTCACCAGAGGTGACGAAATTTTCCCTCCGAAAACATTCCGGTGCGG
GGTTGAGTGGGAAGAAATACCCCTCCCGAAACCTGTGGCCGAACCCGAAC
CGGCAGCCGAAACGCCCAAGAGTCGGGGCGGTTACGGCATATGCGAGGAT
CTTTTGATATCAGACTACGAAGTTTCTGAAGAAGAGGGAGAGGAAGAGGA
GGGGGATGACGAATTAGACCCGAAGTTTCATCGCTTGGAAGAAGAGAAAA
CTTCGGGATCCGGGGTTTCTTCTACTCCTGGCACTAACTCTGCTGCTCCT
GGGCCAGGACAAACTACCTTTGTTGGGGCATCGACGTCATATATGATACC
CGATGATGAGCTCCCCATTAGTCATGAACGCAGCACGAAGGATATGTCGG
TCGAATCATTGACCCAATCGAAGGACCGTGTGCTGCAACTGAAGAGAAAA
ATTGATGAGATGACCGGCTCGGGAGAGAGAGATGTGGTTGAGGTCAATGC
CGAACTGGTAGATATCGAGATCTGCGATGTGCCTGCTCGGCCCGGGGTCA
CCATCGGAAGCTTGATGAACCAGGCTCAGGAATCCTCCGTCTCTCGGAAT
GATAAGAGTAAGGACGTTACGAACGAATCGGGGGGTTCGAATATGCCTGA
ATGTCTTGTGATCGATGACGAGGAAAGTGATCTCGAAATTATCCCGGAAG
AAGCCTTCAAGCGTTACCATCACACCTCTAGAACGCGGGAGCATGCTCAG
AACGATGAAATTGAGAATTCGGACATGGACGAGTCGGACGATGAGGATAC
CAGCTGTCGTGCTCGTGTTCGTAGTCGTCGGTTCAATTATGTATCGTCTG
ATGAGTCTGAGAATGAGGACGAGGACGAGGACGACGAGGAGGATGACGAG
GATTTAGAGGAGGAAGAGCAAGATGGGGAAGATGGGGGCCAGCACGAGAA
CGCTGTAGGGGAACACACCGGGAAGGCTTCCACGGCAAACGATACTGTGG
ATGTCACTATGGTAGCTGATAATCTCTATTCGCCGAATGCCCCAACGCCA
GTGCCCCCCCCGGAGGTCCTGAGCTCAAAACCCCAAGTTGTGGCTGCACC
TTTGGGTGGTATTCCCCAATCTAAGACGAATTTTGCACCATTTGAGGAGC
TAGCAAACGCGGCAGTGGCTGCACAAAACGGGAGTGATTCTTCTAACAAC
CCCAGGGGAAATGTAGCCGCATCAGCGACTATTCCAGAACCTCCCACCCT
TCCGCCCCTCACTATGCTACCAACCGAGGCGGTGGCCAAGAAGACACCAT
CCGGTGCTTCTCATATTCATTGGTTCGCGGAAGATCCACATACGACAACT
GATAGCTTCCAAAAGCGATATAACAACAGTTCTATGGAACAGAAGAAGGA
ATATTTTACTGCTAGACAGATAAACCTTGCGAATTTAGCTAATAGGCCTA
ATGATGTGTTATCTTATTTGAGTCCGGTTCGCGGGAACTCTAAATCACCT
AGTGTGTCACAACCACTGCCCCCGGCTTCATTGCCCTGGGTTCAGACCTT
CAAGACAGCTGAGGGGCCTAAAGAGCCGACTGGGTTGTTCCCTAAGGTCT
GGGAAGATCGGCAGCAAGATTCACAAGCCCCAGCAAACAAGAGCGATAAG
CCGCCTGCGCCGTCTCCACCCCCGCCAACAGTTACTCCTCAAGCCAAGAG
GCTACTTGAGGATGCTGTGGCTGAGGGCGAAAAGTTTAGAGGACTTGATA
AGAGCACATGGTGGTTGGGCGATGAGGCAGAGATCTCAATCGACGAAACA
AGTGAAATGGTCTGGGATGATGAATATTGCAACGATGAGGATGGGGAATA
TGACGAAGAAGACGAGGAAGAGGATGAAGAGGAAAACGGAAATACACCCG
ATGACATCCCTGAACAAGAGATGACTGATGGGATAGTAGATTATGAGGAA
GAGGATGAGGAAGAGGGTGAGGGTGATGTGATGGAGGAGGAGGATGATAC
TGACTCTCGTCATCCTACATGCACTTGGTTCGGCCAACGTAAGGCTTTCA
ACACGGGGTATGAGCGTTTCCCTGTTCATCATCCC

Sequences in the Contig:

SY0AAA26YM03FM1 SY0AAA28YA12FM1 SY0AAA32YG22FM1
SY0AAA34YO17FM1 SY0AAB3YI14FM1 SY0AAB50YB22FM1
SY0AAC14YP13FM1 SY0AAC19YI04FM1 SY0AAC4YA22FM1
SY0AAD39YF08FM1 SY0AAD52YO02FM1