Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3731
Length(NT) : 915
Best Gene Model Blast : Link to GSTUMT00002159001 E-value : 1e-164
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein NFIA_020670
Accession: ref|XP_001265256.1| Score: 253 E_value: 5e-20
KEGG Definition: predicted protein
Accession: aor:AO090003000936 Score: 246 E_value: 1e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3731
TTGGCATGAATGATGAATCAAGGAAATCCTAATACGGTATAATGTTGAAG
TGGAAATATACTACGGTTTCAAACGCCTCGCAAACCTGATCTCTCTCCCA
TTCATGTGGAACGGCCTCAGGTACCGCGGGCGAGTCACCAATTGGCCCGA
AGCCCGTTTAATGGCCCTCCTGATAATATCGACAAAGCTATTATACGGCC
TCGATGGGGTAAAACGTACGCCTAAATCTGCAGTCGAGCCGGCAGCTACA
GGGTTGAAATGGAGAGCATGGGATGGGTACCTGCGAACTAGTAACGCTGA
GCATCGAGGACTTCTCAGCGGGAACGTCACACCAGGAAGTGAAGGAGGGG
AAAGAGGGAGGGGAGTGGGAGGGAAAGACTTGGAAGTCGATGTGGAGGAG
AAGGACGTATTCGACATGACCGGAGAGGAATTGGATAGATATATGGATTG
GTTCGAAAAGAATTGGGCAGATGACTCTAATACACCCCTTACTAAACAGA
TAATTGATTTATTCCCTACTGGCCGCGCGGCGGCTGAGAGAGCTGGAGTC
CACCAAGCCTACGATGGGCCCCGGAGTGGGGCTCCCGCAGATAAACCGGC
ACAACATGACCTTACGGATGAAAGGCTGCGAGAGCTAAATTCTCAATTCG
AGATATACCCCGCCCAGCAGCAGCCAGAAGAAGAGGAGGGGGAAGAGGAC
GAAGAGCAGCAGCAGCAGGGGGAGGGGGATAATTACTCGTCACCACAACC
ACAACCACAGCGAGGAGAGCTCGTAACCAGACCGGGAGGTCAGTACCTTT
GGCATTCAATCCCGACGGAGTTGCCTGTTGAGCAACAGACTCTTCTACAA
GCTGGAGCGGACCTGTTGGCTATCACCAGGGATGATTTGGCTAGGATTAT
TAAGGTTCTAGAAAC

Sequences in the Contig:

SY0AAC14YP08FM1 SY0AAD45YK09FM1 SY0AAD48YA11FM1
SY0AAD48YE02FM1