Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3730
Length(NT) : 1584
Best Gene Model Blast : Link to GSTUMT00006919001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: homogentisate 1,2-dioxygenase
Accession: ref|XP_001247541.1| Score: 1639 E_value: 1e-180
KEGG Definition: homogentisate 1,2-dioxygenase (HmgA), putative [EC:1.13.11.5]; K00451 homogentisate 1,2-dioxygenase
Accession: afm:AFUA_2G04220 Score: 1631 E_value: 1e-180
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1417 Score: 1339 E_value: 1e-148
PFAM Definition: HgmA, homogentisate 1,2-dioxygenase. Homogentisate dioxygenase cleaves the aromatic ring during the metabolic degradation of Phe and Tyr. Homogentisate dioxygenase deficiency causes alkaptonuria. The structure of homogentisate dioxygenase shows that the enzyme forms a hexamer arrangement comprised of a dimer of trimers. The active site iron ion is coordinated near the interface between the trimers..
Pfam Number: pfam04209 Score: 1264 E_value: 1e-139
Swissprot: Q00667|HGD_EMENI

Sequence:
>Contig3730
TTGGAACCCATCCTCCCCCCCACCAATAAGAAAACCAGAAGCAAACATGC
CTTTCACTGCATTCAAGACACCCGATCCTTACAAGTACCTTAACGGCTTC
AATTCTTATCACGAGACCGAGGCCATACCTGGCGCCCTTCCGATTGCACA
AAATTCTCCACAAAAACCTCCCTACGGGCTCTACACGGAGAAACTCTCAG
GTACGGCATTTACGGCTCCGCGTGCAACTAACAAGCAAACATGGCTGTAC
CGAATCCTCCCCGCCGCTTCACATACCCCCTTCATCCCCGTCTCAGCGGC
TTATGGGGGCTGCCCGGCCCCCTCGATGTACCAGTTCCACCAGATTCCTA
ACCAACTCCGATGGGATCCTTTCGACCTTGACGAGTCGGCGGATTTCATC
CAGGGGCTACATATGATTGCTGGTGCCGGGAATGCGTCCATTAGAAATGG
TCTTGGGATCTATGCTTTCGCTGCTGGGAAGGATATGGATAGGAGGGGTG
CGTTTTACAACGCGGATGGTGACTGGTTGATTGTGTTGCAGGATGGAGAA
ATGGACGTCCAGACGGAGCTTGGACGATTATATATCCGCCCGAATGAGAT
ACTGATTCTCCCCCGAGGTATCCGTTTCCGGGTATCCCTTCCCGCCGGAC
CTATCCGGGGCTATGTTCTCGAGATCTCCACAACTGGTCACTTTGAGCTC
CCCGAGCTCGGTCCGATCGGTAGCAATTGTCTCGCTAACCCGCGAGACTT
TCAGGTTCCAATCGCAACCTTCATCAGTACCCCACCAGACCCCCCAAACT
CTTATACCATCACCTGTAAATTCAATGGGGGGCTTTTTACAGCGACTCAA
CCTCACACTCCTTTCGACGTAGTAGCCTGGCATGGTACCTACTATCCTAT
GAAGTACGACCTGGGAAGGTTTAATACCATCGGCTCCATCTCATACGATC
ACCCCGATCCTTCGGTTTTCACAGTGCTGACAGCGCATTCCTCAACTCCG
GGGACTGCAATCGTCGACTTTGCCATTTTCCCGCCCAGGTGGTCGGTTGC
GGAAGACACCTTCCGCCCGCCATGGTTCCACAGAAACAACATGAGCGAGT
TTATGGGGTTGCTATCCGGCCTTTACGATGGTAAGACATCCGGCGGATTT
AAACCCGGCGGTGCAAGTCTTCATAACATTGCAGCCGGCCACGGTCCCGA
TGCCGGGACCCACGAGAAGGCTTCTGAGGATCCACTGAAACCGACAAAGG
TGGGAGAGGGTGCAATGGCGTTCATGTTTGAGAGTTGTTTCATGGTGGGT
GTGACGGAGTGGGGGTTGAGGACTTGTAGGAAGATCCAGGAGGATTATAA
CACGGAGAGCTGGGGTAGGCTGAAGAGGAATTTTTCGCCTCCAGAGGGGA
AGTGGGGGGAAGATGAGAGTGGGGATAGACTCGTCGTTACGGTATAGTGT
CGCTGTCTCCTTGGTTGGACGCGGTGATGAGTAATGCGCATTGAGGCTGC
TCGCTTGCGAGCTTCGGTAGTTTGTGCTTTAATGTTGCTGGTACGCTTGT
ACGGTAGTTTATCAATACTCATTGGTTCAGCTAG

Sequences in the Contig:

SY0AAC14YO23FM1 SY0AAC19YE06FM1 SY0AAC19YE06RM1
SY0AAC20YD16FM1 SY0AAC22YJ15FM1 SY0AAC24YK11FM1
SY0AAC25YF02FM1 SY0AAC28YB21FM1 SY0AAC28YE22FM1
SY0AAC32YG17FM1 SY0AAC32YG17RM1 SY0AAC34YM13FM1
SY0AAC44YI18FM1 SY0AAC49YI08FM1 SY0AAC53YL11FM1
SY0AAC53YN16FM1 SY0AAC56YE24FM1 SY0AAC56YK17FM1
SY0AAC59YE02FM1 SY0AAC61YJ12FM1 SY0AAD12YC13FM1
SY0AAD22YE14FM1 SY0AAD23YA07FM1 SY0AAD26YI20FM1
SY0AAD28YH21FM1 SY0AAD32YE07FM1 SY0AAD32YH17FM1
SY0AAD33YK13FM1 SY0AAD41YK15FM1 SY0AAD43YC15FM1
SY0AAD45YM09FM1 SY0AAD49YI01FM1 SY0AAD51YD12FM1
SY0AAD53YL05FM1 SY0AAD5YJ03FM1 SY0AAD7YF12FM1