Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3729
Length(NT) : 762
Best Gene Model Blast : Link to GSTUMT00009251001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein FG03977.1
Accession: ref|XP_384153.1| Score: 663 E_value: 1e-67
KEGG Definition: hypothetical protein
Accession: fgr:FG03977.1 Score: 663 E_value: 5e-68
KOG Definition: No Hit Found
PFAM Definition: Abhydrolase_1, alpha/beta hydrolase fold. This catalytic domain is found in a very wide range of enzymes..
Pfam Number: pfam00561 Score: 129 E_value: 2e-08

Sequence:
>Contig3729
TTGGAGGAGGTGGATGAGGAGGACCACAACGGTGCCGCTCCAGCGCCTGG
ATCTTCCGAGAAATCGATCCGAAAGGGATCGTAAGCGCAGTTCGAAGCAG
TATCCAAAACGTGCGGACAGCTTGAATAGTGGGATGGGGCGTTCGCCTAG
CAAAGCCAAGCGGAGGTCGGAACCGCAGAGCATCCTTGCGAATCAGTTTG
GACAACAGCAGGCCTCTCCCCCACGCCCGTCTTTTCAAAGCGCCCCACCC
GAGACGACTCATCACGAACGTCCCTCCTCCGCGGACTCTATCGATGACGC
AGTTGATTCGTACCTGTGCTCTCCACGTCTTTCGCAAAAGATCCGTATGC
CTACTACTGGGCGTATTATCTCGTTCTCGGAAGTTGGCGACCCCAGCGGA
TTCGCGGTTTTTGTCTGCGTAGGGATGGGCCTGACGCGCTATGTTACGGC
CTTTTATGATGAGTTGGCGTTGACTCTTGGTCTCAGACTGATAACGCCGG
ACCGACCTGGTGTCGGCGAGTCTGAGGGGATTGACGAAAATGAGCGAACA
GTTCTTAATTGGCCCGATGATGTGCTCTATATTTGCCAGTCACTCAAGAT
TACAAAGTTTTCGATATTGGCTCATTCAGCTGGCGCAATTTACGCACTTG
CTACAGCATTGAGGATGCCTGGGCATATAAGGGGGAAGATTCACTTACTT
GCCCCTTGGATTCCGCCTTCTCAAATTGAAGGTGTGGTCGGTACGGGCAA
AGAGGGTGAGGA

Sequences in the Contig:

SY0AAB30YI10FM1 SY0AAB60YD15FM1 SY0AAC14YO22FM1
SY0AAC42YB18FM1