Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3727
Length(NT) : 879
Best Gene Model Blast : Link to GSTUMT00002777001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_01411
Accession: ref|XP_001559852.1| Score: 157 E_value: 6e-09
KEGG Definition: hypothetical protein
Accession: ncr:NCU03461.1 Score: 152 E_value: 1e-08
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2072 Score: 113 E_value: 2e-06
PFAM Definition: TolA, TolA protein. This family consists of several bacterial TolA proteins as well as two eukaryotic proteins of unknown function. Tol proteins are involved in the translocation of group A colicins. Colicins are bacterial protein toxins, which are active against Escherichia coli and other related species (See pfam01024). TolA is anchored to the cytoplasmic membrane by a single membrane spanning segment near the N-terminus, leaving most of the protein exposed to the periplasm..
Pfam Number: pfam06519 Score: 109 E_value: 5e-06

Sequence:
>Contig3727
TTGGAAACAATCCTTGGGCACCCAGAGACGCGGCGAGCCAGATGTGCACA
GATACGGGCGCAGATCGCAGATCTGCTCAAGACCCAGGATGAGAAAATTC
ACGTCATCACTACTGCGAATGAGGCGTTGCAAAAGCACCTTCAGCGAATC
GAGCATACCTTCGGGTATGTACAGATGGAAATACCAGGCACGTATCGCCT
GGGAAGCACAGAGCATTGGGCATACAAGGATCCAGTCAAGAAGGGTACAC
TTGCGGCACAGGCTAGAGCTGCTGAGAAGGCACAGAAGGAGGCGGAGGAA
CGGCATAATCAACAACAACAACGAGAGATAGAAACCTCTAATACTCGTTC
AGAAACAAGGCGCGAAGCACTTGCAAGACAGAAAGCCGCTGCCGCTGCCG
CCGCTGCCGCCGCCGCTCTAAATGATGAAGAGGAACAATCCACACGGGAG
CAAAACAGTCAACAAACTCAGCCTGTCAAGAAGCTTCATGGTAACTCTAA
GATTAGGAAAGAGCAAGAAGCTTTGGCCTCGGCAAAGCGTATGGCAGAAC
ATCAATCCGCGACTGGAACTGGTGGGATGGTTCCAGCGTCTAGTCCCGCG
GTACCTCCGCAGCAACCAAAGCGGCGGAAAACTACCAATAATAATAATAC
AAAGGAAGGGCCAGGCCCAGCTACGGCTCCAAACGCAATAGCGGGTGATA
AGCCACCCACTGTGGAACCGGCGATCAAAGCTATGTCTAGTCCCAGGATA
GGGACGCCATCCGCTGGAAGCAAGAGGGGGGGCAAGTCAGGTACTGCAAC
CGGTGGGGGTAGGGGAGGGCGAAGTAGGCACCCGGGAGGCCCTGCAGCAT
CGCCTAACCTTGCATCCTCACCAACCCAC

Sequences in the Contig:

SY0AAA22YB03FM1 SY0AAB60YH17FM1 SY0AAC14YO04FM1
SY0AAD14YM02FM1