Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3725
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00003398001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_09662
Accession: ref|XP_001227589.1| Score: 185 E_value: 2e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG00334.1 Score: 175 E_value: 1e-11
KOG Definition:
Classification: [Inorganic ion transport and metabolism, Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0039 Score: 148 E_value: 1e-10
PFAM Definition: No Hit Found

Sequence:
>Contig3725
TTGGACATAATCGCCACTGTCGGGATGTTAATCGTTGACCGAGTCCTCCG
AGTCATGTCTACAATGTCCACTACCGCAACTATATCTCTAGATCCTCGGT
CTTCAATCCTGGATATATTAGTCTCCTTCCCGAACAAACCGCCCCCACCC
GCGGGATCGCACATCCTACTCAACGTCCCGTCGCTATCACTATGGGCAAA
GAACCCCTTCACGGTCGTCGAGTCTGGGAGCGGGCACGTGAGGATGGCAG
CAAGAGTGCGAGGAAACTTCACGAAGAAATTGGTGAGGGTGGCTAAAGTT
CCCGTAAATATCGAAAGTGGGTATGGCGGGCATGGGGTCAGCAGAGAGTT
GGTTGGCGGCGTGGATAGAGCGCTGCTGATTGCCGGAGGGATTGGCGGGA
CGTTTGCCCTTCCTTGGGCGCGGTTTCTGAAAGCCAATGGTGTCGATGCC
AGGTTTCTGTGGGTTGTTCCGAAAGTGGGCGACTTACTGTGGGCTCGGGA
TGGAGTCGCTTTGGCCGAGGTTTATATCACGGGAGGGCATAACGGAAATG
GCGAGGGCAGAGACGAAGAAGGGATGGAGCTCCTTGATGCGAGTAGTTCT
CGGGATGCGCTGAGCGCTCACCCGCTCA

Sequences in the Contig:

SY0AAC14YN11FM1 SY0AAC15YN11FM1