Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3724
Length(NT) : 726
Best Gene Model Blast : Link to GSTUMT00006689001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: alpha-1,2-mannosyltransferase (Alg9), putative
Accession: ref|XP_001268871.1| Score: 445 E_value: 2e-42
KEGG Definition: hypothetical protein
Accession: ncr:NCU04454.1 Score: 445 E_value: 8e-43
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2515 Score: 460 E_value: 7e-47
PFAM Definition: Glyco_transf_22, Alg9-like mannosyltransferase family. Members of this family are mannosyltransferase enzymes. At least some members are localised in endoplasmic reticulum and involved in GPI anchor biosynthesis..
Pfam Number: pfam03901 Score: 350 E_value: 4e-34
Swissprot: Q8VDI9|ALG9_MOUSE

Sequence:
>Contig3724
TTGGAAACTACTCGTACGGACTACAAACGACAGAAAAAACCTGGATTTCT
CACACTGAAGCACGGCTTGGGTTTTAGGAGAACCCGGAAACTTCAAGATC
TCACAAAGCTCGGGAACGACGGTGTGCATTATGGCAGAAGTGCGCTCCAG
GGGCCAAGCTCGAAGGAAAGGGGCCGGAGGAGACGGAGGTGGATATCCAA
CTCCCAGCTCACCCGAAAGGGTGTCTATCTCGGAAACCAATGCGGAGAAG
CTCGTTGGACCACACGTGTCTCATCCGATTATCTCTCCAACATCAGCGTT
TTCGATTCTGCTTGTCGTCCGATTGCTTTCTGCAGTGTATGCTACCATCC
CAGATTGTGACGAGGTCTTCAATTATTGGGAACCTGCTCATTACCTTACA
CATGGATACGGTCTTCAAACGTGGGAGTATTCGCCGGTATACGCTATTCG
TAGTTGGGCCTATGTGGGACTACATGCCATTGCCACTAGAGCGATATCTT
TAGTCCCCCAGCTTGAGAAGACCTATGAGTTCTACGGCCTGAGGTGTTTA
TTTGCTGTGTTTTGTGCTTACTCTGAGAAAAGACTGTACGCAGTGGTATC
ATCGAGCATCAACCCGAGAGTCGGAATTCTGTATCTTGTACTTACTATCG
GAAGCGCTGGCATGTTCCATGCGGCTGCCGCGTTTCTTCCATCTACCTTT
GCTATGTACACCACAATGCTCGCAAT

Sequences in the Contig:

SY0AAA21YI10FM1 SY0AAB4YP02FM1 SY0AAC14YN08FM1
SY0AAC61YC10FM1