Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3723
Length(NT) : 723
Best Gene Model Blast : Link to GSTUMT00000720001 E-value : 2e-06
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_02992
Accession: ref|XP_001596769.1| Score: 163 E_value: 1e-12
KEGG Definition: predicted protein
Accession: aor:AO090012000226 Score: 162 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3723
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAGAAAATCGATGTCGAA
TCGTCTTCCCTGCTGCTGGATACGAGTAGAGATGTTGAAACCGATATTTG
GGCACTTGGCATAACAGAGAAGTCAATCTCAGCCGAGGTTGTTGGGAATC
CATACAATCCTGGAGATCTCGATAGATAGGGTTGGTCCTGGCAAGGATGC
ACAGCCGAACGATATCCCGAAGGAGCAATTTGATTTCATCCATATACGAT
ACAAGAGCACCGGGGTGACGGATAGCCCGCGAATGTTCCGTTTGGCATAT
GAACAAACAAAACCCGGAGGCTGGATCGAAGTCGTTGAGAATCCTCCCTC
GTCTTATACGACCTGTTCACCCCTGGATGATGGCACACAATGGAAAGGAG
GGGCGGTCCCAACCAGCTGGGCCGTCAAAGATTTTACAACATCTAAGATG
GCGTTCTGGATCAAACAGCAACTGATAGAGGCTGGGTTTGTTGAAGTGGA
GGAGAAAGTATGGAGGGCACCAACTGGCCCTTGGCAGAAGATTGTTGGAA
TCGGGAGGTTAATCTACTCTCTTCTTAGCTTGAGTTGGAGCAATAGTAGG
GTCAGTGAGATGGTAAATCCAGGGGAGACATACTCAGTCTCTCGTGGGCC
AACTGTATTCGTTATCGCGAGGAAACCCTGAATTAGCGATCGGAAGTGTT
GGTTGTTTTTTGATGGTTAGAGG

Sequences in the Contig:

SY0AAC14YN01FM1 SY0AAD43YA06FM1