Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3722
Length(NT) : 2155
Best Gene Model Blast : Link to GSTUMT00002871001 E-value : 0.0
Numbers of ESTs : 66

Blast Results:

Nr Definition: hypothetical protein CIMG_02030
Accession: ref|XP_001248259.1| Score: 1140 E_value: 1e-122
KEGG Definition: hypothetical protein
Accession: ang:An01g09350 Score: 1109 E_value: 1e-119
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0255 Score: 386 E_value: 1e-37
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 419 E_value: 2e-41
Swissprot: P38227|YBP3_YEAST
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0015559 = Molecular function: multidrug efflux pump activity
GO:0006855 = Biological process: multidrug transport

Sequence:
>Contig3722
TTGGCCAACTTTTTTGTACAAAGTTGGACTCAGGGCAGTTTTTTCCTTTT
TTTCTTTTTTCCCTTGGTCCTTGTATATCTTTCTCATTGTTGGTAATAAC
TTCCTTCACACTCGATCACGCAACAGCGGTGCATTGTTGAAATCTAGCGT
CATATACGGTAGACTAATGGAGGGGGCACGAACTGCGCGGAGCTCCACTG
CGGAGGGAGCCATAGAGGGCGATTCTCCGACAAATCCCTCTAACCCTCCA
GCTCCGATAAACAGCGATGATAGCAATAAACCTTTTCCGCCAGCCACCAG
AATGGCGACAAACAAGTCGTGTATTGTCCCGTGGAGTAGGAGAAGGGGCA
TGTTTGGCCAGCTAGCGCTAGTGCCCGAGATTGAAGATGCCAGAGATTAT
GGAAAGCTTATCAAGTATCTGATCACCATCCTTGTTGCCGCCGCCGGGTC
GACAGCTACGATGGCGAGCACCATATTGTTTCCTGCCCTATCGGAGGTAT
CTGAGGAATTGAACTCGACCCAGGTCATAGCAAACCTGTCGGTTGCCTTG
TACATGCTATCGTTGGCGATATTCCCTCTCTGGTGGTCCTCCATATCCGA
ACGGAGGGGCAGGCGGACGGTGTACATAGTATCGTTTTCCCTCTTCACCA
TATTTTCAGCGTGCTGTGCAGTCTCGACCAGCATTAGCATGCTGGTTGTG
TTCCGTGTCGCCTCCGGCGGCGCGTCGAGCAGTGTCCAGGCCGTCGGTGC
GGGGACTATTGCGGATATTTGGCAGGTCAGTGAAAGGGGGAAAGCTATGG
GTTGGTTTTACTTGGGCCCTCTCTGTGGACCTCTACTGGGACCAATTCTG
GGAGGAATATTGACTCAAGAGTTCGGATGGAAGGGGACACAATGGTTCTT
GGCGATTTTCGGACTCTCTCTGTTCTTCGGAATGCTGTTTTGCCTCCCGG
AGACCCTACGAATCCAGGATAAACCCAAGGATATACGTATGGAGACACCC
GAGCTCGGTGATGGTAAGTTGCCCACAGGAGAAGAAAGGACTACGGATCC
ACCAGGTCTACAAAAAACCATCTCCCAAGTCTCTAGAAGAAGCTTGAGAA
AGGGCAAACAATGGATCGAAACTGCAAAGATCATCCTGGTCGATCCTCTG
AAAAGCCTGCTCTACCTGCGCTTCCCGCCGGTATTGTTAACTGTGATATA
TGCCGGTGTAACTTTTGGAGCCATATACATCTTGAACATCTCATTGCAAG
CTGCCTATTCTCAAGAGCCATACAACTTCTCCCCACTCATTGTGGGACTT
TTGTTCATCCCTGGCCCTCTCGGTTCCGTGATGGCATCGTTAGCGGGTGG
CCAATGGTCCGACACCATAATGCGACGGGCCGCGATAAAGCGAAGGGCGG
CTGCAGGCGGGGATGAAAGCGCTCCATTGGAGTACCGGCCGGAAGACCGC
ATGGGAGTCAATGCGTGGATAGCAGGAATTATGCTCCCATCTGGGTTGGT
CTGTTATGGATGGATTGTGCAGCAGGGGTACCACTGGGCCGCCCCCTTGC
CCCTTGTCTTCATCTTTGGATTTGGAAGTATGTTGGTGCTCGGAATGACC
ACCACCATGTTGACTGAGTTTGTCCCCGGACGAGCTAGTTCTACTGTTGC
GGTCAATAATTTTGTTAGAAGTATTTTTGCCTGTATTGGGGGTATCGTTA
CCGAGCCCATTACAAACGCGGTTGGGAATGGCTGGCTGTTCACAGTACTC
GGCACACTTGCTTTAGCAGCTCTCAGTGTGATATGGGCTATGCATAGATA
CGGACCCAAATGGAGAGCCGAAGCTCACAAGTACAGCTTCATGTGATAAA
CGGACTCACCGATATGCCCCTGTTCATCTGGGATAGACTCTTCTCACTTC
TTCTCCTTCTACCCATTTCTGATACTTGTTTTTTTTTTGTGCTCTCACCT
CATCCGTTTTCATGGCTTTGAGGCCTTTGTTTATTCAGAGCCTCTTCCCG
GGCCATTATGTGGCGTTTAGGTTTGTATATAAATTCTCTCGTATTCTTCT
TTCTTTGGTCATGTTTGGGCGTGAGGGGAAAATTGCATAGAATATGTGGG
GCAAGAAATGACAATATAGTAATGCTACGATACATATATTACTTGTAACT
TTTAC

Sequences in the Contig:

SY0AAA45YC15FM1 SY0AAB51YO10FM1 SY0AAC14YG09FM1
SY0AAC14YL19FM1 SY0AAC16YE05FM1 SY0AAC17YL14RM1
SY0AAC18YF14FM1 SY0AAC20YH01FM1 SY0AAC20YH01RM1
SY0AAC22YP20FM1 SY0AAC24YF24FM1 SY0AAC26YH20RM1
SY0AAC26YP03FM1 SY0AAC27YN02FM1 SY0AAC27YN02RM1
SY0AAC28YA06FM1 SY0AAC31YK17FM1 SY0AAC32YK19FM1
SY0AAC32YK19RM1 SY0AAC32YM19FM1 SY0AAC33YC09FM1
SY0AAC33YK10FM1 SY0AAC33YP20FM1 SY0AAC36YE02FM1
SY0AAC36YM19FM1 SY0AAC39YN20FM1 SY0AAC40YD14FM1
SY0AAC40YJ07FM1 SY0AAC43YK07FM1 SY0AAC45YJ09FM1
SY0AAC49YH14FM1 SY0AAC50YC07FM1 SY0AAC51YM08FM1
SY0AAC51YP21FM1 SY0AAC52YM10FM1 SY0AAC54YP03FM1
SY0AAC56YL14FM1 SY0AAC57YE07FM1 SY0AAC57YI11FM1
SY0AAC59YB14FM1 SY0AAC62YG06FM1 SY0AAC62YO09FM1
SY0AAC7YD06FM1 SY0AAD11YG18FM1 SY0AAD12YH21FM1
SY0AAD14YE23FM1 SY0AAD15YJ15FM1 SY0AAD18YH07FM1
SY0AAD24YL06FM1 SY0AAD25YK18FM1 SY0AAD25YN04FM1
SY0AAD2YD09FM1 SY0AAD35YB23FM1 SY0AAD39YM20FM1
SY0AAD40YM19FM1 SY0AAD42YF24FM1 SY0AAD44YG19FM1
SY0AAD44YK13FM1 SY0AAD49YF14FM1 SY0AAD50YN23FM1
SY0AAD51YC23FM1 SY0AAD56YG19FM1 SY0AAD59YB19FM1
SY0AAD63YF15FM1 SY0AAD6YI11FM1 SY0AAD6YN20FM1