Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3721
Length(NT) : 843
Best Gene Model Blast : Link to GSTUMT00009297001 E-value : 0.0
Numbers of ESTs : 69

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61523.1| Score: 706 E_value: 1e-72
KEGG Definition: asparaginase
Accession: aor:AO090102000492 Score: 706 E_value: 6e-73
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0503 Score: 324 E_value: 6e-31
PFAM Definition: Asparaginase, Asparaginase..
Pfam Number: pfam00710 Score: 348 E_value: 1e-33
Swissprot: O88202|LPP60_RAT
Gene Ontology:
GO:0004067 = Molecular function: asparaginase activity
GO:0004622 = Molecular function: lysophospholipase activity
GO:0006528 = Biological process: asparagine metabolic process
GO:0006644 = Biological process: phospholipid metabolic process

Sequence:
>Contig3721
TTGGCCCAACTTTTTTGTACGGGGTTGGGTGAACCTTACATACTCGGACC
CACAAACCTGATAGCGACAAGATAAGGAAGCTATGACTTTTCACCTGACA
ACACCAAGTCCGCACAACTCGACTCCTAGTAGCTCAACCACCAACAGTAC
GCCCGCGTACGGAAGTCCCCAACATGGCTCGCCAACTCAGTCAAGCTTTC
CTACCTTTGATGGCCCTGGGGAAGACGGCCATTCCGTTGCGGAGAGCAGG
GTTTTAATAATCATGACAGGAGGGACGATATGCATGCGTATGGGAAAAGA
CGGTTACGTTCCCGCCACTGGCTTTCTCGATGCCTATCTCAAACCCAGGC
CGTCTTTCAATGATGGCTCGCCTACTAAATGTCTTCCTGTCATGACTGAT
GACGAGACGGAAGTGATGCTCGAATCTTTGCGCACCCCTCCTTCCAAACA
TGCTCGCCGCATTCGATACGCAATTCTTGAGTTCAACCCCCTCCTTGATA
GTTCGAGTATCAACGCCAAAGGTTGGGGTGAGATTGCAAAATCAATAAAA
CGCAATTATACACTTTTTGATGCGTTTGTGATCTTGCACGGTACCGATAG
CTTGGCTTACACAAGCTCTGCACTGAGCTTTATGATCAGTAATTTGGGGA
AATCGATTATCCTAACAGGTTCCCAAGCACCAATGGCGGAGCTCCATAAC
GATGCTACAGACAATCTTCTCGGAAGTCTCATTATTGCTGGCCATTATAT
GGTACCTGAAGTTTGCCTTTTCTTTAACCATAGGCTATTTCGTGGAAACC
GAGCGACGAAGAGCAATGCTCACGACTTCCGTGCCTTCTCATC

Sequences in the Contig:

SY0AAC10YJ01FM1 SY0AAC13YF16FM1 SY0AAC14YL18FM1
SY0AAC14YM15FM1 SY0AAC16YA09FM1 SY0AAC1YJ13FM1
SY0AAC1YL21FM1 SY0AAC22YC01FM1 SY0AAC22YM11FM1
SY0AAC24YL02FM1 SY0AAC27YD17FM1 SY0AAC28YA07FM1
SY0AAC2YG09FM1 SY0AAC2YN17FM1 SY0AAC32YH15FM1
SY0AAC33YF14FM1 SY0AAC33YO12FM1 SY0AAC35YD21FM1
SY0AAC35YF15FM1 SY0AAC36YL18FM1 SY0AAC38YB13FM1
SY0AAC38YE17FM1 SY0AAC38YK03FM1 SY0AAC44YD10FM1
SY0AAC44YI23FM1 SY0AAC45YG20FM1 SY0AAC46YD18FM1
SY0AAC48YC14FM1 SY0AAC49YD20FM1 SY0AAC50YM02FM1
SY0AAC51YB19FM1 SY0AAC51YK18FM1 SY0AAC55YC02FM3
SY0AAC56YF13FM1 SY0AAC61YG11FM1 SY0AAC62YN15FM1
SY0AAC6YE10FM1 SY0AAC7YK22FM1 SY0AAC9YM01FM1
SY0AAD11YE17FM1 SY0AAD11YI06FM1 SY0AAD13YO02FM1
SY0AAD15YG04FM1 SY0AAD17YD18FM1 SY0AAD17YF09FM1
SY0AAD17YI16FM1 SY0AAD17YM10FM1 SY0AAD22YM15FM1
SY0AAD23YM06FM1 SY0AAD28YE15FM1 SY0AAD29YC09FM1
SY0AAD30YD01FM1 SY0AAD32YM16FM1 SY0AAD33YL18FM1
SY0AAD35YK01FM1 SY0AAD35YL11FM1 SY0AAD3YC07FM1
SY0AAD40YB14FM1 SY0AAD41YM03FM1 SY0AAD43YD07FM1
SY0AAD45YC04FM1 SY0AAD45YC21FM1 SY0AAD49YP08FM1
SY0AAD51YN13FM1 SY0AAD55YC20FM1 SY0AAD55YO12FM1
SY0AAD55YO23FM1 SY0AAD56YG15FM1 SY0AAD59YD04FM1