Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3720
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00004095001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3720
TTGGCTCGTCCTGTCCTCTTAAACCTCTCTCCCTCTACTTTCTTGTTGTC
TTTGTCGATAGACCCCTTTGCATCTTTCGGGACAAGGAATCTGCCCCTCG
GGTTGAGCCGCGTCCCAATAGCTTTGCCCTACCTTGTTGCATAGATACTG
GAACCCGCGAACGGAGGCGCTTTCTTTTTAGATATATATATATATTTTCT
GCCTCTTGTGAGGTCACTGTTTATAGTTTGTTGTCCGTTTTCGAGCCTTG
GTCGAAGTATCTCGACGAAACCCTTCCGGAAACCTTCTCCAAGACGTTCC
TAAAGGTTTCAAGGAAATCTTAGGTTATAACTGTCCCTACCCCTTCCACC
GCTCTAAAAATGGTCCTGGTGAATGACCAAGCTATGGAAACTCGTCTTAC
TAAAGCACCGCGCACTTCTCGTCGCCAGAGATTCCTCGCTCGCATTACCC
GCAATTCATCTTCCCCGCAGCTGTCAAAGCTTAATCCGGAGCCACCGTCA
CCCGTTAGGGACCAGTATTTAAAGGATCGTTCCGTCTCGTGTATCTCCCT
CTACCTGACACGCCCCATGACTCCCGCACCGGAACGCCCGCTCGGATTCC
GGGTTGCGGAGACGTTGGATAAGCCGCACCAAGGCGGGAACTCGTGTGTT
GGGATTCCTAATTCGGTAAGGAGGAAACCTGTG

Sequences in the Contig:

SY0AAC14YL16FM1 SY0AAC56YK20FM1 SY0AAC7YG08FM1