Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig372
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00007445001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_14553
Accession: ref|XP_001804735.1| Score: 109 E_value: 4e-11
KEGG Definition: hypothetical protein
Accession: ncr:NCU02375.1 Score: 94 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig372
TTGGGCGCCGCTACATCTATCCCGACCAGATCTCCGAGCTCAAGTCGCCG
CTTCCACCCCTCTCCCTTTACCGCATCACTACCAACCACGCACCTCTCAC
ACCCACCACCCACCACCCCGGACACGATTGTCCACCGCCATGGGCTCAAC
CACCATATTGAATCGCCCGCAGGCTGCTTCCGCATTGTCAGCTTCACCAA
AAGTTGTCAAAAACAACAAATCTCTCGCTAGCAGTTCGGCCGCTCCTTTA
ACCTATGGTTGTAACCATATCGAAAAGCCTCTACAGGGCCCTACGGAGGG
TAATAAGATGAGGGTCCTTTACGGTAGCGCCACTCGTGTGGCTTTGGATT
CAAGCCGGGCACATGCGCAAACTTGTGAGAAGTGCAAGTTTCTCATAACG
AGAACCTTCCTTTGCATGCAATGTCCGAGTATATACTGTCCCAAGGACGC
AGAAGCTCACTATAAGGAAAAGAATCACCGTTTTGCGGCCATGTTTACTG
CTTCCCTTGCCAGGACTTCATATATGATCCAGCATTGGAGAAAATTAGGG
TGGAAAAGGAGGTAGCTATGGAGGGGGGTGCTCGGAAAAGGAGGCGATTG
GATGATATCAAACCCTCACCCGAAGATCTTAAGTACATCGAGTCGAAT

Sequences in the Contig:

SY0AAA22YE08FM1 SY0AAA39YE16FM1 SY0AAC51YI07FM1