Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3719
Length(NT) : 1154
Best Gene Model Blast : Link to GSTUMT00006750001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001541577.1| Score: 919 E_value: 4e-97
KEGG Definition: DUF221 domain protein, putative
Accession: afm:AFUA_2G09070 Score: 862 E_value: 8e-91
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1134 Score: 588 E_value: 2e-61
PFAM Definition: DUF221, Domain of unknown function DUF221. This family consists of hypothetical transmembrane proteins none of which have any function, the aligned region is at 538 residues at maximum length..
Pfam Number: pfam02714 Score: 639 E_value: 2e-67
Swissprot: Q03516|RSN1_YEAST
Gene Ontology:
GO:0016020 = Cellular component: membrane
GO:0006893 = Biological process: Golgi to plasma membrane transport

Sequence:
>Contig3719
TTGGCACGGAAACGGTTCCATGGCTGAGGTGGATCGATAAGCTTCCCAAC
TCTGTTCTTGGTTTGATTCAAGGTGTTTTGCCTCCATTGGGTTTGGCAAT
CCTGATGGCATTGTTACCCATTATCCTTCGTGCATTTGCGAAGCTTCAGG
GAAATCACACTGGTATGGCCATCGAGAGGGCTGTTCAGGGAATGTACTTT
GCCTTCCTGTTTATCCAAATCTTCCTCGTTGTCAGTATCTCTTCCGGTAT
CACTACTGTTTTCCAGCAATTAGCGGACAACATTGCATCTGCACCAGCAA
TTTTGGCCCAGAATTTGCCGAAGGCGTCCAACTTCTTCTTCTCATACCTG
TTACTGCAGGCATTCACTGTCAGTGGTGGAGCAATTCTGCAGATTGGAAC
ATTATTCGTACAATTCATTCTTAGTCCGATTGTTGACTCTACTGCTCGTC
AAAAGTTCACCCGGGCGACAGAGCTTGCCCAGATGAAATGGGGCACTTTC
TTCCCGGTATATACGAATTTGGCGTGCATTGGGATTATCTACTCGATCAT
CTCCCCATTGATCCTCATCTTCAATATCTGCACTTTTAGTCTTTTCTGGA
TGGTATATCGGTACAACCTTCTCTACGTCCACAACTTTCGCTTCGATACA
GGAGGCTTGCTCTTCCCTAGAGCGGTCAACCAGTTGTTCACGGGAATATA
TGTTATGGAGGTTTGCTTGATCGGTCTCTTCTTCCTTGTCCGGGATACCG
AAGATCGTGTTGCTTGCTTTCCTCAGGCAATCATCATGATCGTTGTCACC
ATCTTCACTGTCCTATACCAGTATACGTTGAACTCGGCTTTCGGACCACT
ATTAACCTACCTGCCCATCACTCTGGAAGACGATGCTGTTCTCCGCGATG
AAGCGTTCGCAAAAGATAATGAAAAGCGAAGACTATTAGCTAGCGGCAAC
ATCGTTCCAGAGGAGCAGGAAGGGGACGATCTCAATGAGGTTCTAGCAGA
GCGGGAAAAGCGGGAGAGACGCATGGATCGACGTGCGGATGAAATTGAAA
TGCGGAACATCCAGAACGTCCGCGAAAATAAGAAGGAAGGAAAGCCATCT
CTCTTCTCAAGAGGTAGAAGCCACGCCGAGACGCCAGACGTCGGAGACCC
AGAA

Sequences in the Contig:

SY0AAA62YI20FM1 SY0AAC14YL11FM1 SY0AAC29YA16FM1
SY0AAC61YI04FM1