Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3718
Length(NT) : 2072
Best Gene Model Blast : Link to GSTUMT00011601001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: acetolactate synthase
Accession: ref|XP_001260823.1| Score: 1414 E_value: 1e-178
KEGG Definition: thiamine pyrophosphate enzyme, putative [EC:4.1.-.-]; K01671
Accession: afm:AFUA_2G13620 Score: 1408 E_value: 1e-178
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG1185 Score: 315 E_value: 2e-29
PFAM Definition: TPP_enzyme_C, Thiamine pyrophosphate enzyme, C-terminal TPP binding domain..
Pfam Number: pfam02775 Score: 196 E_value: 1e-15
Swissprot: P20906|MDLC_PSEPU
Gene Ontology:
GO:0050695 = Molecular function: benzoylformate decarboxylase activity

Sequence:
>Contig3718
TTGGCGTTCATTATCCATTGAAACAAAGCTCGTTTGCCCCCCCAAAACCA
GTTACTCAAGCTAAGCATGTCAGTGCCCTGGACTTCCCAAGACATTTCAC
TTTTCTTACCGATAAGCGGGAAGTATTGTTGTGCAAACCAGTTACTCAAG
CTAAGCATGTACACCGCTTCGTTCGCCTTCTTCGAGGCGTTATGGGAGGC
GGGGGTCACACATTGCTTCGTGAACTTGGGATCTGATCATCCAAGTATTC
TCGAGGCGATCGTAAAGGGAAAACGTGAGAGGCCACATAGTTTTCCGGAG
TTTCTTACTTGCCCAAATGAGGTACTCGCTTGACTGTGGTTGAGTGTTAG
GTTACTGGAGGGTCTAATCAACTAATGCTACCTGAGTAGATGGTTGCTTT
GTCCGCAGCTCACGGAATGGCACAAGTCACTGGAAAGCCCCAGGCTGTTA
TTGTGCATGTTGACGTAGGGACACAAGGTCTCGGAGCCGCTGTTCACAAT
GCTTCGTGCAGCCGTGTTCCTGTCCTCATCTTTGCCGGTCTCTCGCCCTT
TACACAGGAGGGTGAAATGCGCGGTAGCAGGACAGAATTCATCCACTACA
TCCAGGATGTGCCGGATCAGAAGGCGATAGTAGCACAGTACTGCCGGTAT
TCCGCTGAGATTAAAACTGGAAAAAACATCAAGCAGATGGTCAATCGCGC
AATTTCCTTTGCCATGTCTGATCCCAAAGGCCCTGTGTACCTTACTGCTG
CTAGAGAGGTGTTAGAAGAAGATATTGAACCTTATAGTCTCAATCAGGCT
GTCTGGGATCCCATTAGCCCTACGGCACTCACAGAGGATGCTGTGGGCAG
AATCTCACAGAGTTTATTGTCCGCTGAGAATCCGTTGGTTATCACCGGCT
ATTCCGGGCGAAACAAATATGCTGTGGAGGAATTGATCACCCTGGCCGAT
TCCGTGCCTGGATTGAGGGTTTTGGATACATTGGGTAGTGATATGTGTTT
CCCAGCGAATCACAGAAGCTCACTAGGTGTCATGTATGGCTCTCATGAGA
AGATCACCACGGCAGATGTGATCTTGGTGATTGATTGCGACGTTCCTTGG
ATCCCTACTCAGCCATCCCCCAGAGCGGCGGTCTACCACATCGATATAGA
TCCGCTGAAGCAGCAAATGCCCCTCTTCTACATTGATGCGGACGCTCGCT
ACCGAGCCGATGCGTACACAGCTCTAAAACAAATAAACTCTTACACCGCG
GTAATGAAAATGGATGCAGCTACCCGCGATGCACGAATTCAGGCGCTAGA
TAATGAACACAAAACGCGCATGGACAGACTAGAGCAGCAGGCAAAGCCCC
GCGACGATGGACTGCTCTCCTGCGCACATGTGATGAAAGTCCTCCGAGGC
GCTATTCCTCAGGACTCAGTGATCATATTAGAAGCGGTCACCCAGACTGT
TACAGTGGTAGACCAAATGAAGTGCTCCCTGCCAAAGACTATATTCAATT
CCGGTGCCGGAGGACTTGGCTGGTTCGGTGGCGCCGCTCTAGGCGCAAAG
CTCGCCCTCGATAATGGCACCTCCAACTCTGGCCCATTCGTCGTAGCAAT
AGTTGGTGATGGCACATTCCTATTCTCAGTCCCAGCATCAGTGTATTGGA
TCTCCCGCCGCTACAAGATCCCATTCCTAACAATCGTCATCAACAACGAT
GGCTGGAACGCCCCGCTACGATCTGCGAAACTGGTGCACCCGGATGGACT
CAGTGCGCATGCCACGCCTGAGGAATTGAACATTAGCTTCAAGCCTAGTC
CGGATTATGCCGGTATCGCGGTTGCGGCGGCCGGAGGGGAGATTTGGGGC
GGGAAGGCGGAGAAGGTGGAGCAGTTAGCTAGTGCTCTAGAAGAGGCGAT
TGGGGTTGTGAAGGGGGGGAGGAGCGCTGTTGTTGAGGTTGTTATTGTTT
AGATATGGGATTGCGGGGGTAATGATTTTGCACACACCTATGTACTGATG
GATTGGTAGATAGGTAGTTTGAGAATCGTAGTCTACGATCCTACTTAATA
GCTCAAAGTGGGGAATGGAACC

Sequences in the Contig:

SY0AAA25YC09RM1 SY0AAB48YP03FM1 SY0AAC14YL01FM1
SY0AAC2YP21FM1 SY0AAC37YE04FM1 SY0AAC49YH18FM1
SY0AAC6YF03FM1 SY0AAD42YO16FM1 SY0AAD6YC16FM1