Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3717
Length(NT) : 1770
Best Gene Model Blast : Link to GSTUMT00012092001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein BC1G_11740
Accession: ref|XP_001549982.1| Score: 726 E_value: 2e-74
KEGG Definition: hypothetical protein
Accession: fgr:FG07231.1 Score: 680 E_value: 2e-69
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4194 Score: 118 E_value: 1e-06
PFAM Definition: No Hit Found
Swissprot: Q9UUG2|YFT6_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig3717
TTGGATTACTGTTCCCCCCCCACCCCCTAAATACCAGCGCTCTTTTTTAT
CTCGCCGGAATTTTCTTCGGGGTTCCGATAGCTTGGACCTTTCTTGTGTG
CGTGAGAAATAATTATAATTTCTACCTTCTGCTTTCCCTGGTTTTCTGTT
GAAGAAGAAAAAAAAAAAGGAAAACCCGTTTTCGGTGGCCTTGTCCAGTT
TACTCTCGCGATAAGCTTTTTCCAAACCACTCTCCTTCCTCGAAACAGAG
ATAACCTCCCCGAACCTGCATGCATTCATAATGGACTCCGAGGACGGTCA
TACATACATCAAGCATCTTGCTCACTTCGTTCGTACACACGAGAAGGCCC
TCGCAAATGCTCTACAGCTTCAAAGGCGACAGCCACGTCGTAGCGACACG
GCTCCGGCCGTGTCTGGAAGGACTCCTGCCAGCCTTCAATATGTCCATGG
CTCCTCTTCCACCTCCAGCACTCTGGCTGCTGCCTTCTCGCTTCCGTCCT
TGTCCTTCACCTCGCAGCACCTTAAACCTGCAAAATTGGGACTCACGCCT
CACCACCTCTATTACCTCTTGAGTCGGTTCGAGGAGCTCAACATCCCGGT
TGGGCCTATGGGGGTTCGTCTGGAGAACATTCATGCGGAGAGCTCACCAG
GCAATTATGTTTCGTTCTTGAGGGATGCATCTGGACGTAGGAATCATTCA
TCGGATAGCTTGTCAATACACTCCGTGTCCAGTGTCAGGAGTGTCATGTC
TGGAATGTCATCATTGTGGTCTTCCATCGGACTCGGGACGTCCGCTTCGG
TCAAGAGTGAGAGGGCAAAGGCAGCCCTGGAGGCCGATTTGAAATACCTC
TACTCAGCATTCACTAAGATACCATGCTTGAGGCTTGCACCTGATAGGAA
AGCTCGTCTGATTGAGGGGTTTGAAGAGTTTCCTTTTGATACTGCGGTCC
CCTTGTTGGCATTCAAGAATGTTAGTGCATTGGAGATTTGTGATATTGAT
ATCCGCCAATTCTTTGGATGGGACCAACTGGCAGAGAGGCTACGAAGTTT
GGTTGTGAAACGGGGTGGGATCAAGGACCCCTCCGAACTTATCATTGCTA
TTGTCCTGGATGACATGGACAAGAGACGCCGGAGATCTGCTAAATCTTCA
TCTTCGCCAATAATTTCGTATCCTTCCTCTAGCCCTGGTCTGGGCAATGA
GGGGGAGCCATCGACTCCGCCCTCTCCAACCCTAGGTCAGATTGGTAGCA
GCAGTGCCCCTGCCGGCCATTACCATGCCATGTCTAGGGTTCCCTCCAAT
TCCTCAAGGTCGAGCTCCAAGAACCGACCCCGCAGCAATTCGCCTACAAG
ACCTGCTAGCTCTAGGACTAATTCTACTGCTACGAACTCGCATTCTCGTT
CCCACAGGATGCGGAGATCTGGCTCTGGCAGTAGCCACTCGTCGTCAACT
TCAACTCTTCTTCCGTCGTCCCATGGACTGACACTGCCAGCCATTCTCCC
CAATACAAAATGGCGCTTCTTGAGACACCTCTCTTTGGCGGATAATGGTT
TACTATCGATCTCCTCAGCTGCCCTGACCCCGTTGGCTGGCTCCTTATCG
TCGCTCGATCTCTCGAATAACCTTTTCAAGTCCATTCCCGAGTGTCTCTC
CATTCTTTACAATTTACGTGCTCTGAACCTTTCTGGAAACATGATCGATT
CTCTCCACTCCTTGACCCGAAATCCACTCCCGGCCATAACCGCACTTAAC
CTCCGTGGCAATGTGCTAGC

Sequences in the Contig:

SY0AAA11YK13FM1 SY0AAA31YO11FM1 SY0AAA58YM21FM1
SY0AAC10YL10FM1 SY0AAC14YG19FM1 SY0AAC14YK21FM1
SY0AAC15YC17FM1 SY0AAC37YI03FM1 SY0AAC41YB19FM1
SY0AAD38YP21FM1 SY0AAD7YB20FM1