Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3716
Length(NT) : 1048
Best Gene Model Blast : Link to GSTUMT00006244001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59932.1| Score: 781 E_value: 2e-87
KEGG Definition: 17 beta-hydroxysteroid dehydrogenase type 3, HSD17B3 [EC:1.1.1.-]; K10251 beta-keto reductase
Accession: aor:AO090026000492 Score: 781 E_value: 8e-88
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1014 Score: 633 E_value: 1e-66
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 212 E_value: 7e-18
Swissprot: P38286|YB09_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0045703 = Molecular function: ketoreductase activity
GO:0030497 = Biological process: fatty acid elongation

Sequence:
>Contig3716
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCCAACACAACGGAAAGGC
CGGCCGAGCTCCCTTCAAAAGAAAGAGAGAGAGACCCTTCTCCCCCGAAA
CCATCTAACACTGATTTCCAGGTTGCCGCAAAACACAAATATCATGACGT
CCTCCGGCGAATTTATTGCCAAGATCTCCTCCTTCATTGGTCCAATTGGG
CTGTCCGCTTTTGCTCTACTGGGTGCTGTCACTTTTCTCAACGTTTACCT
CAAAATCTTCAGTGCTTTCTCGAGTCTGTTTATTCTTAGTGGAACAAATC
TGCGTAAATTTGGGCCGAAAGGGTCGTGGGCACTCATCACCGGCGCTTCG
GATGGTATTGGAAAGGAATTCTCCCTGCAACTCGCCGCGAAGGGATTCAA
TGTTGTTCTCGTCTCTCGCACCCAATCGAAACTCGCTACCCTAGCCCAGG
AAATAGAATCGAAGCACTCCGGTATCGAGACCAAAGTTTTGGCCATGGAC
TTTGCGAAGAATGACCCGCTGGACTATGAACGTTTGAGGGCTTTGGTGAA
GGACCTGGACCTCGCGATCCTGATCAACAATGTTGGGAAAAGCCACAATA
TCCCTGTCCCTTTCTTGGAAACGGCCGAAAAGGAGATGGACGAGATTATC
ACCATCAATGTTAATGGTACACTCAAAGTTACTCAAATCGTTGCTCCGGG
CATGGTCTCTCGAAAGAGGGGGTTGATCTTGACCATGGGCTCTTTCGGCG
GTTTACTTCCTACACCCTTTTTGGCGACCTACTCTGGCTCAAAGGCTTTC
CTTCAACACTGGTCCACCGCCCTCGGAGCCGAACTCAGACGCGATGGTGT
GCAGGTTCAATTGGTTGTAGGTTACTTGATCACCTCTGCTATGAGCAAGA
TTCGCAGACCCAGCATGGATGATTCCTACACCGAAGGGTTTTGTTAAGGC
TACACTTGGGAAGATAGGGCTCAAGGGGACTGCTGCGGGTATGGAGGGTA
CTATTACACCATACTGGAGCCATGGCTTGATGCATTGGGGTGTTCAGG

Sequences in the Contig:

SY0AAB44YD22FM1 SY0AAC14YK19FM1 SY0AAD34YE18FM1
SY0AAD40YL09FM1