Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3715
Length(NT) : 1328
Best Gene Model Blast : Link to GSTUMT00005798001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_751013.1| Score: 271 E_value: 7e-22
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_6G11290 Score: 271 E_value: 3e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3715
TTGGCCTTCCTCCCCCTCCCCCCCGCTCTCTAACGTCCTCTTGGGGTGTT
AACTCTCTCCTAAAATATTCACCCGTCACAATCCTTTGCAGTCGTCATTC
GAATCTAACGGAACCAGTGAGAAGTCGAGTTCCTTTTGGAAGTGAGCAAA
CAGCTTGGTTATCCAGTTGTCTCCCATTCGGTAACGATCGAGAGCGGACT
CTGGGCTGTCGACGCCATGTTTGCTAGGAAATTACAGCTTCCTTTGCTAA
ACGTTACCGATGCCGACACTCTCGTTTTCATCTCGCCCAACACATCACCC
AACCCCCCTCATCGGGTTTCTTCAAAAGCCCTCCTTGCGAGTGGATCAGC
GGTTTTCAGGGAATTGCTTGGGCCTACATCTCAGCATAGGGCTTTGAGGA
AGAGGAGACTGGTCAACGTCCTTCCACAGGGGATCAAATACGTTATCGAT
CTGAGCCCTCCGGAGGAGGGACCCGAAGCCTTGGATGCTGTTCTAAAGCT
CTACTGTCCAAAGGTAGTTCTTGAATGGCAGAGCGGGGTTCCCAACGGAG
CATACCTCGAGGATGATGACCACCAATATCAGAGAGAACTGTGGCAGGTC
AACTCGGAAAGGCGTATCGCAGACTTGCATAAACACGGTACGTGGGAAAC
TACTGAGGAGAATTGCGATTCCATCTCAGATGTTGACCTCTCCGAGGTTA
AAGTGACACGGCGAGGATCTGGTACTGGAGATGCTGGAGTAGAGCTGATG
AAGGGTGAATGGATTGAGCCAACTCCGCCGGCAGCCCATTCCACAAGACG
CCACAGTGCAGCCATTGAGAGGATACTCCATATTATTCATGGGTTGGATC
CACAACTGTGTACCACTCCCATGTGGTATACCGTATGTAAGGTGGCAGTC
CTGCTCAATTGCGAATCGGCCGTTGTTGATCACGCCACGAGTTGGTTATA
CGCCGACGGGAAATTCATAGGAAAATATCCAGAGATCGTGATGGAAATAG
CTAATGACCTTAAAAGTAAGGTCTTGTTCAAGGACGCATTTGCGCTTCTC
GTTGGGAAAATGCTCCGTGCCAATGAATCGGATTCTGAACAGGATGCCCG
TTGCTTCGACAGAATTCCAGAAGCGGCTCTACCTTGGAAACGCAATATTA
TGCATGCTTGTTGGTCTTTGAAGGCGCGTGTTAAAAAAGCCCATGACCAT
CTCATGTCTGTCCGTGAGTGGCTCTACAATCCTATTTGGATATCCGAATA
TGAAAAACTGGCTAGAGTTCTCTCTATCCCAAATCTGGACCACGAAGTTT
ACGAGGCCAGCATCGCGCTACGTGATGC

Sequences in the Contig:

SY0AAA8YL09FM1 SY0AAC14YK05FM1 SY0AAC28YK06FM1
SY0AAC31YI11FM1 SY0AAD15YA24FM1 SY0AAD19YC13FM1