Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3714
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00009259001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4849 Score: 106 E_value: 8e-06
PFAM Definition: DUF605, Vta1 like. Vta1 (VPS20-associated protein 1) is a positive regulator of Vps4. Vps4 is an ATPase that is required in the multivesicular body (MVB) sorting pathway to dissociate the endosomal sorting complex required for transport (ESCRT). Vta1 promotes correct assembly of Vps4 and stimulates its ATPase activity through its conserved Vta1/SBP1/LIP5 region..
Pfam Number: pfam04652 Score: 112 E_value: 2e-06

Sequence:
>Contig3714
TTGGACTATGTTGAATCGCCAAGTATTGGTCCTTCAGGAAAAGCTGAGGT
AGTGGGTGAAGAGGGCGGCGTCAAGGGGGGCACGGGAAAGAGCAATGGAG
TGATTGTTTCGAAGAGGTTTGACGAGGAGAACATTCAGAAGGCTTTCGGA
GGAAGATTCGAAGGGAATGGAAGCGGGCTTTCGATAGCAAGCGTGCATGT
CACACCCGCTCAGGAACAAACTTTGGATAGGGTTGGGGCTGACCAAAAGG
CAAGAACACCTGCGGGAGTGGAAATCGAAATGGGATCCACTCCGACACCT
ATTGGGCCCGAGGAAAAGGAGGAAGGGGAATCTTCTCAGCCGCCAAACAC
ATCGTCTGAAGCTTCAATAGATCTGTTAGCCAGCGAAGCTGGGACCTTAT
CCATCTCCCCCTTAAATCCGGAATCGGTTCCTGCGGCCCCTATGGACTCG
TTGATACCCGGGAACGACGGTGAGGATTATAGACCTCCTACACCTTTGAA
GGACGATGCGCTTGCAAAGCGTGAACAGGATGCTGCTCTTTCTACTCCTC
CCCCCCCACCTCCACCAAAAGACGTGCCACCAAAAGATGTCCCACCAAAG
GACGTTCCACCGAAAGATGTGCCTCCAAAAGATGTGCCGCCAAAGGATAG
GGTGCATCTTTTCCCATCGACTATGCCCCGGCC

Sequences in the Contig:

SY0AAA16YI07FM1 SY0AAA50YF21FM1 SY0AAC14YJ21FM1