Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3713
Length(NT) : 1601
Best Gene Model Blast : Link to GSTUMT00011448001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein BC1G_07392
Accession: ref|XP_001554255.1| Score: 589 E_value: 1e-92
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06748 Score: 582 E_value: 2e-92
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0119 Score: 475 E_value: 5e-48
PFAM Definition: No Hit Found
Swissprot: Q8NIW7|BBP_NEUCR

Sequence:
>Contig3713
TTGGCACAGCTCTGCCCGGACTCATCCCAAGTCTCGTTGGGGAAGCGAGT
CAATCAAGAGCACTATTAGCGTTGACAACCTGCCTGCTTCAATTCCAGTG
TGTATGAGTCTTGAGGATACCGAGATGTATGTACGTAAAGTACGCATCGA
GGAGATCACTCAGAAGCTTACTACTAATATGATTGTGCCAAATGACAAAC
GATCTCTCTCTCCGGACCCTATTTATGACACGACCGGTCGTCGCATAAAT
GTTAGAGAGACCAGATACCGAGAGCGTCTAGAAGCTGAGCGTCATGACTT
GGTGGCAAAGGTTTCACAAATGGATCCGCAATACAAGCCTCCTAGTCAAT
ATAGAAGACCTGTCAACAAGCATGAAAAGGTCTATGTACCTGTCGATGAC
TATCCAGAGATTAACTTTAGTAACTATTTTCTAACCCCTACTAATCAAGC
GAATTCCGTATTTAAGACGTACAGAAAACAGCACAAACTAACATCTTGAG
CACGCCTGTGCTCGTGATTCTGCTAGTTGGCTTGCTCATTGGTCCCCGTG
GACATACTCTCAAGCGTATCGAGAGAGAGTCCGGGGCTAAAGTTGCCATT
CGCGGCAAAGGCTCTATCAAAGAGGGGAAAGCAAGGAGTGATCTCGCCGT
GACATCTGACCAGGACGAAAACTTGCATTGTCTCATCATATCACCCAACC
CGGCCTCTACCGTCAAAGCCAGGGAAATGATTAACGAGATTATCGAGACT
GCTGCGTCGACACCCGAAACCATGAACGCACTCAAGCGTAACCAGCTCAG
GGAATTGGCTACCTTGAACGGGACCTTACGCGATGATGAAGGAAAGACGT
GCTCAAATTGCGGTGAGGTTGGTCACCGAAGATACGACTGTCCCAAAGAG
ACCAACTACACAGCAGGGATAATTTGCAGGGTCTGTGGTAACGGGGGGCA
TTTCGGCCGAGACTGCTTAGACCGCCCGAAAGGTCAAGGTTGGCAGGGGA
AACCTTCCAATTCCAATCCTCGAGACCAAGAATATGATGAATTTATACGA
GATGTCCTAGGAGATGCAGAACCTGCTGCTGGGGAAATTGCAACCGCTCC
TACTGAGGCAAACCTTCATCAAGCTGGTGGTGATAACAGCCAAGGGAGGG
AATTGGGGTCTGCCCAAGCCCCGTGGAAACAGGCAGGCGGGACCCTAGTC
AAGTCATCGGAGCCTAGTTCAACCGCTGCCGAACCCCCGTGGCGACGGCC
AAGTACATCTTTCATCAAACCTCATGAGATCAGAGAGAATCCCATCCCTA
AAAGCTATCAAGCCCCTTGGGGCCAAGCTCGCCCATGGACACAAGTAGGA
AGTGCAAACGGGGGCTCGGGAGGCATGGGTCAATTCCAAAATAGCGGAAA
CAGTAACTCGCGTAACCCGCTCGCATCCAATGGTCCCCCCGATAATATCG
GATCCAGAGAGAGAGGCACCGGCGCTGAGATGGAATTTGGGGCCAGCAGC
AATATCTCTCTACAGAAATACCCCAGCGAATATGGCAGCTTTGGGGATTC
TCAGGGCTATGAGGGAGACAGACAGGTGACTCATAGTAACCCACACGGTT
T

Sequences in the Contig:

SY0AAB25YA06FM1 SY0AAB54YM04FM1 SY0AAC11YK02FM1
SY0AAC14YI16FM1 SY0AAC42YB01FM1 SY0AAC51YP17FM1
SY0AAC61YN13FM1 SY0AAD10YH21FM1 SY0AAD3YI08FM1