Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3711
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00012225001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: tyrosyl-tRNA synthetase
Accession: ref|XP_720447.1| Score: 727 E_value: 3e-75
KEGG Definition: CaO19.10209; tyrosyl-tRNA synthetase
Accession: cal:CaO19_10209 Score: 727 E_value: 2e-75
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2144 Score: 700 E_value: 1e-74
PFAM Definition: tRNA-synt_1b, tRNA synthetases class I (W and Y)..
Pfam Number: pfam00579 Score: 314 E_value: 6e-30
Swissprot: P36421|SYYC_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004831 = Molecular function: tyrosine-tRNA ligase activity
GO:0006437 = Biological process: tyrosyl-tRNA aminoacylation

Sequence:
>Contig3711
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCACTCGCTTGCTTCTCTTC
AAACTCCTGGCTACCCACCCGTTTGCGCCCCTCTCACGATCAGACCATCT
ACCCCATAAAACGAAAACAAACAAGCCCATCGTCAAAATGGCGTCCACCA
CTACCACCATTGACCTCACCCCACACGAAAAATACGACCTGATAACCAGT
AACCTACAAGAAGTTCTAAAGCCAAACATCATTAAATCCGTGCTGGCCGA
GAACCGCCCCCTAAAGATCTACTGGGGTACTGCGCCAACAGGCCGTCCGC
ACTGCGGGTACTTCGTACCGATGGTGAAGCTCGCTCACTTCCTGCGCGCA
GGCTGCGAAGTCACAGTTCTGCTAGCAGACATCCACGCATTCCTGGACAA
CCTAAAAGCCCCTCTGGAGCTAGTGACGCACCGGGCAAAGTACTACGAAC
TAGTCATAAAGTCCGTCTTGCGAGCCATCGGGGTCCCGATTGAGAAGCTA
CGCTTCGTGCTCGGGTCCTCGTACCAGAAGGGGGCCGCGTACGTTATGGA
CTTGTTCCGCCTCAGCTCTATCGTTACCGAGCACGACGCGAAGAAGGCGG
GTGCGGAAGTGGTCAAGCAGGTTGCAAGCCCTTTGCTAAGCGGCCTGATT
TACCCGCTCATGCAGGCGCTCGACGAGGAGCACTTGGGCGTCGACGCGCA

Sequences in the Contig:

SY0AAA60YN20FM1 SY0AAC14YG17FM1 SY0AAC42YK17FM1