Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3710
Length(NT) : 1372
Best Gene Model Blast : Link to GSTUMT00006363001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Pneumo_att_G, Pneumovirinae attachment membrane glycoprotein G..
Pfam Number: pfam05539 Score: 115 E_value: 2e-06

Sequence:
>Contig3710
TTGGGAAAATCCGGGGGAGCTGGCGATGCCTTGATGAAGAGTAATTGTTA
AGTAGTGGGCCAAGGTAGAGACTTGTTTTCATAAGATCTTTCTTTTTCTA
TGCCTAGGCAGTATTCATAGACTCGTGAATCGTGATATACTCATACAGTG
CAAAATCCGTGGATGCAAAAAAAAAAAAATCGAAAACCATACCCAAAAAT
CAAAATATAAAAGTGGAACAGAAAAATCCCTGGATATCAGAGTTGAGACA
CCACTAATCCCCCACGTTACCTCAACCTGTTCCAAGCTTCTCTTCTTTCT
TTTTCCTCCTCCTTCTCTCCTTGCATACTTCTACAAATTCCTTCTTCCAC
ACCTCCACCGCATCCAGCAACCCCATCTCATCTTTTAAGGGAGCATATGC
AAGCGCCAATCTCTCAATTCTTTTCAACCCATCCTTGAGCATGTTCACCT
CCGCCTCTGTCTCGTCAACTGTGCTCCTGCAGTCCACCACCATTAGCAAT
CTCACAGACGACTATATGGGCTGAGGGGTACTAACTCAAAAGGCAGCCTC
TCGATCTCCTCCCTCAACCTCTCAATCTCTTCATTCGCAGCCTACAACAT
CATCTTAGTAACCCCCCCCCAGCAGAATCCCACAAACGCATAGAAGAAGG
GGGGGAAGGGGGAAAGCGCACCTTCAACTCCCCACCCATCCTCCGCAACC
CTCCTTTAACCCTCGCCAGCCCCCCTTCACGAGCAGGACTACCACCACCG
ATCCCTGTCAACACTACCGAATTCGTCATAGACCTACTCTTCCACTCAAT
CTCCTCCCTAGCCCTCCTCTCCCTCAGCAAATCCCTCAGAGAATCTGTAA
CTGCTGTTTCCAAACCCCAAATCCTGGCCGTCAAGCTCTCCTCCCTAGTC
GCGAACGCTTCCCGCTCGGAAATCAGTGCGTCCTGGAGGTACTGCGCCTT
CTCCAGATCGGACGTGACCACGATCGGCTCCGCCGGTGATAGTGACGATG
GGGGAGACGGGGAAGTGGTGGGAGCGAGTGCGGATCCGGGCACGGGCTCT
CGCAGGAGCAGCTGGGAGCGGAGTTCCTCATTCTGCTTCAGGAGTTCGGA
ATTTAGGTTTTCCAGGTCCCTGATCCGCGTCTCGTAGGAAGTTATTTGCA
GGCGGGTGCCCGAGTGGCTGGTAGTTAGTGTTTCGAGGAGGTGGAGGATT
GAGTCGTAGGTATCGGCTTCCAGTGGAGTTCTCGGCGGTGTATGTGAGCC
GTTCATCGCGCCATATGTACCGCGCTTGTACTTTTTTTTTTTTTTTTTTT
CTCTCTCTTGTTTTCAAAGGGTCTTTTTTTGTTTGGCAGGGGGGGACAAC
TTTGTACAAAAAAGTTGGCCAA

Sequences in the Contig:

SY0AAC14YG12FM1 SY0AAC14YG15FM1 SY0AAC57YA08FM1
SY0AAD27YB01FM1