Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig371
Length(NT) : 1286
Best Gene Model Blast : Link to GSTUMT00001678001 E-value : 0.0
Numbers of ESTs : 34

Blast Results:

Nr Definition: GTP-binding nuclear protein GSP1/Ran
Accession: ref|XP_001527056.1| Score: 1030 E_value: 1e-110
KEGG Definition: gsp1; RAN-like GTP binding protein
Accession: cal:CaO19.12948 Score: 1029 E_value: 1e-110
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0096 Score: 890 E_value: 3e-96
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 481 E_value: 7e-49
Swissprot: Q9P4E9|GSP1_CANAL

Sequence:
>Contig371
TTGGCAACTTTTTTCCCCCTCTCCCCTCCCCTTTTCTTTTTCGCTCTCAC
TCTTCCCGGCTTTTTTTGCCTCACCCAAACAAAAACTTCATCCACTTCGT
TCATCCGCCTCGACCTCCAATTTCCATACAAAGGGCTCCCTCATCGTCGC
CTTTTCTAGTCTCTCGCATACAAACCTTTAGACAATGACCACTCAAACTC
AGGTTCCGACCTTCAAGCTCGTGCTTGTCGGTGATGGTGGTACCGGAAAG
ACTACCTTCGTCAAGCGTCACTTGACTGGTGAGTTTGAAAAAAAATATAT
CGCCACTCTTGGTGTCGAGGTCCACCCTCTTGGCTTTTTCACCAACTTCG
GTGAACTCAAGTTCGATGTTTGGGATACCGCTGGTCAGGAGAAGTTTGGT
GGGCTGAGAGATGGGTACTACATCAATGGTCAATGCGGTATTATCATGTT
CGACGTCACTTCTAGAATTACCTACAAGAACGTTCCCAACTGGCATCGTG
ATCTCGTTCGCGTTTGCGAGAACATTCCTATCGTTCTTACGGGAAATAAG
GTCGACGTTAAGGAGCGCAAGGTTAAGACCAAGGCCATTACTTTCCATCG
CAAGAAGAATCTTCAATACTACGATATCTCTGCCAAGTCGAACTACAACT
TTGAAAAGCCTTTCTTGTGGTTGGCCAGGAAGCTCGTTGGAAACCCGACT
CTTGACTTCGTTGCTTCCCCAGCTTTGGCTCCCCCTGAGGTCACTGTCGA
TACCGAGGTGTTGGCAGCCTACCAGCGGGAGATGGAGGATGCTGCTCTGC
ACCCTCTTCCCGACGAAGATGATGCGGATTTGTAAACGTGTCACCCAGAT
AAAAAAAAAGTTCTCACTAGTTTACTCCAAAGACGATGTGTTAGATGGTG
CTCAGATGGATAACCGTTTCTTTTTTCTTTGATACTCGCTCATGTTTCTC
TTTTTTTCGTCGCAAATCCCTTTGATTTTTACGTTACTATTGGGACCGCG
CATGTTGGAGCTCATAGGGATAAATGGAGGGGAATTCAATTCACGAAACC
TTTCTTCTTGCTGGTCCGGATTGCCGGAGAAAATCATAATCGAAAGTAAA
ATGGACAAAAAAAAAAACTTTTTTTTAGTTGGAGATGGGTTGGGTCTTCG
GTGTCTTTCCTTTGCTTTTTCTTCTCTTGCGGGTGCATTCGGTTGAGCAA
GCGAATGAAATGATTGAAACGATACAGTGGAGCTGGTAGAACGGCTTGAG
ATTTCTCTATAGTTTTTGCCGTGAGAAGGGGGGGGG

Sequences in the Contig:

SY0AAA10YC10FM1 SY0AAA1YL07FM1 SY0AAA22YE07FM1
SY0AAA22YM07FM1 SY0AAA24YI20FM1 SY0AAA24YI20FM2
SY0AAA34YE05FM1 SY0AAA37YE01FM1 SY0AAA38YN17FM1
SY0AAA40YE11FM1 SY0AAA49YA04FM1 SY0AAB23YE10FM1
SY0AAB24YF06FM1 SY0AAB2YN21FM1 SY0AAB30YC17FM1
SY0AAB32YJ06FM1 SY0AAB34YJ04FM1 SY0AAB37YP02FM1
SY0AAB38YO23FM1 SY0AAB39YJ14FM1 SY0AAB49YI13FM1
SY0AAB56YL06FM1 SY0AAC23YI02FM1 SY0AAC28YP03FM1
SY0AAC29YJ18FM1 SY0AAC3YC06FM1 SY0AAC41YO20FM1
SY0AAC49YP24FM1 SY0AAC4YE03FM1 SY0AAC61YO20FM1
SY0AAD13YN05FM1 SY0AAD40YJ12FM1 SY0AAD42YE07FM1
SY0AAD53YI15FM1