Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3709
Length(NT) : 1145
Best Gene Model Blast : Link to GSTUMT00008604001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_504089.1| Score: 345 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: yli:YALI0E18051g Score: 345 E_value: 7e-31
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3423 Score: 350 E_value: 8e-34
PFAM Definition: TFIID_30kDa, Transcription initiation factor TFIID 23-30kDa subunit..
Pfam Number: pfam03540 Score: 215 E_value: 4e-18
Swissprot: Q12030|TAF10_YEAST
Gene Ontology:
GO:0000124 = Cellular component: SAGA complex
GO:0046695 = Cellular component: SLIK (SAGA-like) complex
GO:0005669 = Cellular component: transcription factor TFIID complex
GO:0016251 = Molecular function: general RNA polymerase II transcription factor activity
GO:0042802 = Molecular function: identical protein binding
GO:0000114 = Biological process: G1-specific transcription in mitotic cell cycle
GO:0016573 = Biological process: histone acetylation
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig3709
TTGGCTCCAAACATACCCAAACAGCCTCAACCTTCTTTCAACGAGCCCTC
CCTCCCTTCACTTAATATAGCCGCCGCCTCTGCACGCCTTTGGGACTATC
TCATCCTAATCGCATCACCTTTGTACCAGCTGGCCTCGTTACTCTAACCC
TGCAAATTTTCTTTTAAGGGGGAGACAGGGGGAGTAATCGAGCGCTACCG
ACTCCTACCGGTATTATCCAACCCTACCGTAATTTAATCCCCCAATCCCA
TACTCGGGAAAAACAGAAAGAGAGAGGCACTCGCCATTATACAAATATCG
TTCACCCCCTCCTCGGAGCGCGTCGATCCCCGTGTGCACCCTTCCTTGTG
AGGCTCTAGCGGTAACCACCGAAACCGCACAAGCCTCAAACCCTTTCTTC
CTTCCCTCTTCCTTTCCTTTCTTCCCTGACTTCTTAACCGGCAGACACCA
CCACCCCTCCTCCCCACAATCACAACAACGCCCGCAAGCTATTCACAAGA
GGAGAGATAGAAAAAAAGAAACGACAACAATGACCAACCAAACCGACCCC
TCTACAACCTACAACCAATCCGGCGCTACTGGCGAAGAAGACACAGAAAT
GGAAAACCAAACTTCCAGTTTCCAAACCAGTAGTACCGTTCCTGACGCTC
CCGGCGGCCTGGTCGGAATTGCCCAACCGGCGCCGCCACCAATGCCAAAG
AAAGACCGCACCCTAAGGGAATTCCTTGGGATGATGGAGGAGTATGCTCC
TATCATCCCTGATGCAGTAACAGACTACTACCTCTCTCTCTCAGGCCTCA
ACACCAATGATCCCCGCTTGAAGCGGTTGCTCGCACTTGCCACGCAAAAG
TTTATCGCAGACATCGCTACGGATGCGTACCAGTACTCGCGCATTCGACA
AACCTCTTCGAATACTGGTGGGGGGGTCCCTGGGGTTGGCGCGTTGGCTG
GTGCGGTTGGCGGTATTGGCAGTGTGGCTGGGGGTGCTGGGGCTACGCTA
AGACCCACCGCTAGGCCTGGGTATGGCGGGGGTGGGGGTGGTGGCGGCAG
TGCCGGAAGGACGGTGTTGACCATGGAGGATCTGGGAAGTGCGGTTGGGG
AGTATGGGGTGAATACTAGGAGGCCGGAGTTTTACAGGTAGAGGA

Sequences in the Contig:

SY0AAA44YF09FM1 SY0AAB19YM04FM1 SY0AAB23YN12FM1
SY0AAB26YL07FM1 SY0AAB39YP17FM1 SY0AAC14YG10FM1
SY0AAC33YB08FM1 SY0AAC39YH22FM1 SY0AAC44YN09FM1
SY0AAC4YG12FM1 SY0AAC56YE14FM1 SY0AAC8YI03FM1
SY0AAD29YO02FM1 SY0AAD51YO05FM1 SY0AAD52YH14FM1
SY0AAD7YI03FM1