Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3708
Length(NT) : 1790
Best Gene Model Blast : Link to GSTUMT00008250001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: RNA-directed RNA polymerase (Sad-1), putative
Accession: ref|XP_001263772.1| Score: 1233 E_value: 1e-133
KEGG Definition: RNA-directed RNA polymerase (Sad-1), putative [EC:2.7.7.48]; K00985 RNA-directed RNA polymerase
Accession: afm:AFUA_3G06790 Score: 1214 E_value: 1e-131
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0988 Score: 652 E_value: 1e-68
PFAM Definition: RdRP, RNA dependent RNA polymerase. This family of proteins are eukaryotic RNA dependent RNA polymerases. These proteins are involved in post transcriptional gene silencing where they are thought to amplify dsRNA templates..
Pfam Number: pfam05183 Score: 314 E_value: 2e-29
Swissprot: O14227|RDR1_SCHPO
Gene Ontology:
GO:0005721 = Cellular component: centric heterochromatin
GO:0005829 = Cellular component: cytosol
GO:0031934 = Cellular component: mating-type region heterochromatin
GO:0031380 = Cellular component: nuclear RNA-directed RNA polymerase complex
GO:0005724 = Cellular component: nuclear telomeric heterochromatin
GO:0003968 = Molecular function: RNA-directed RNA polymerase activity
GO:0030702 = Biological process: chromatin silencing at centromere
GO:0007059 = Biological process: chromosome segregation
GO:0008104 = Biological process: protein localization
GO:0031060 = Biological process: regulation of histone methylation
GO:0016246 = Biological process: RNA interference
GO:0031048 = Biological process: chromatin silencing by small RNA
GO:0045141 = Biological process: telomere clustering

Sequence:
>Contig3708
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGATGTTCACCACGACGGG
TCAGGACGAGGCAAGTCTTGATGTCGACCTCCACCGCCGGGAACTTGACA
TTGTCTTCAAAATATGGTTGAAAAACGATGCGAGTGCCCAGACTAATCAG
TCGCAAGAAGAGGTTGAAGGGGATGTTAATAATTACGACGACGACGATAG
CAATGCTCCCGAAAATAAGCCGACCGAAAGATTCGAGAGGTATCGCTTTG
GGGTTCCCTTTTCCCATTTAGAGAAACTCGTCGAGGTGGAGACTTTATCT
GCTCCGGGTCGTGCATTCCTGATCGACCTCCCTTCGGCACCCCCCTTCTG
GAGGAAACTCCACAATCCACGCCTATCTATTGATGATCGCATCAAGTACT
GGACTTCCCGGAACGCTTGGTTCCGTCAAACGTCCATCACGTTTGATAAT
AGCGCAAGAAAGGGTCTTCCAATCTCCCTCGAGCAACGTGGCCAAACTAT
AAACATTGGCCGTTGGACTACCTACAGATTTGAAGTAGGGACTAAGGAGG
CCGGGTCTGATGGTTTCAACGAGATGATTTCCGCGTTAAAGGATTTTAAC
ATCAAGCTAGATGTCCAAAAGGACTTCAAGACGCTATCCGAGAAATTTGA
TCCTATTTGGGATTACATACGCATCAAGCGTATTCAGTCCTCGGTTTCTT
TTCTGGACCAGCTCCACCAGGCTTCATCCCCTCTCCTTTCCTACCCGGTT
CGCTACCAGCTTGAGGTTTGTATTTCGCATAATTGCCTAAGCGAGTACAA
CATCACTTGTGAATTCATTGACCGTCTAGCAGCGCTTCCTAAAGAAGCGG
CTATACCGCTGCTGGAACACATCGCGGAGAGAAGAATCCGTCATTATGAC
CCAATGGATATCTTTACCATTCAAGGGGTTACCAAGGGCACAATTAACTT
AAAGCTTCCTGATCATTGTCAACTCCTTAGAAAAGCCAATGTAACCCCAT
CGACTGTTTATTTTACTACACCTACCGTTGAAATTACCAATCGGGTGGTA
AGACAATATTCTGAGCACATAGACAGGTTCCTGAGAGTCCAGTTCGTCGA
CGAAAAATCTCAGGGCCGCATAAATTCTACCGACAAAAAGACCATGCATG
AGGTCTTTACCCGTGTTAAGGCTGCCTTGGACCATGGCATAACTATTGGC
GATCGAAAGTTTGAATTTCTAGCTTTTGGCAATTCGCAAATACGTGAACA
CGGTGCATATTTCTTTGCCTCAGATGATCACCTTTCTGCGGCAGATATTA
GAGCATGGATGGGAAGCTTCAGTGAGATTAGGATAGTTGCGAAACATGCT
GCAAGACTCGGCCAGTGCTTCTCTACCACCCGTGCGATCAATGGAGTACG
AGTTGATGTTCGCACTACTGAAGACATTGTGAATGCGGAAGGGTACAACT
TCTCTGATGGAGTTGGAAAGATTTCTGAATTTTTGGCGCGTTTGATCACT
ACTGAGCTTCGTCTCAGGTTGGTCGACAAGGAGCCTGTACCCTCATGTTT
TCAGTTTCGTCTTGGAGGCCGCAAGGGCGTCTTGGCAGTTAGCCCGGACG
CCAACCATCGCGAAGTCTACATCCGGCCTAGTCAGCTCAAATTCGAGGCC
AGACATAACATTCTAGAGGTTATACGCTGGTCCAAGTTTGCGACTGCCGC
CCTCAATCGACAATTGATCATCGTACTAACCAGTCTGGGTGCTCCTGACC
ACTATTTCGAAGACAAGCTTCAATTTATGCTGAAATCCTA

Sequences in the Contig:

SY0AAA13YC23FM1 SY0AAA1YJ05FM1 SY0AAC14YG08FM1
SY0AAD35YH05FM1