Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3707
Length(NT) : 777
Best Gene Model Blast : Link to GSTUMT00005633001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3707
TTGGGACGAAGGGTGCCATCACGAATACATTTTTATCCCCATTTCTGATT
GCCCGTGTCTCTCTTGTTCAGCTACTCTAGGAGGTAAGCGTTCAATGCGC
GGGGGAGGACCTAGTTGCATCTAGCATCTACTGTATAGCTTCTTCCTCCG
CGGCTTTCTTCACATTCACGTCTATTTTCCCACACACACCCCCGTCCACT
CCTTCCAATTCTCGACAAATCCCGCTCGTCAAACCTACTCACGAGTGGTG
CGCCTAGGACATCTAAATACAAGGCTCTATTTCAGGGAAGTGTTGTCCTC
TCTTCATCAGAGCGGATAATGTCGACTCCTTCGGACCTCCCTCTCCTGCG
TCCAATTCCCCGTCGCCCACAAACAATCGAGACGGCTTCCCCATCCCCCT
CTCCCAATGCTACTCCATCGCCCCTCCTATCTTCCCCAGATAATCTCGCA
TCACCGGCGGATAGCCTCTCTCCCACAGAATTCAGACCCCCAAAGCGCAC
CAAGTCTGCAATCGCCTTAACCTCGTCTACACTCTTCGGAATCTATTCCC
TCTCTGACGATGCAAACAAGGACACTGAGCCCTCTACTCCTTTCCTATCT
CGCAACTCGTCTGTCCTTGATATGGCCGACCTCGACATTAAGAAGGTAAC
TCCATCTCATGTGCCCGTGAAGCATACTCGGAAGGATCCAGTTCCGTGGT
ACGAGGTCGCTATGAGGGGCATGGCCCTATTCGCTTTCGGCGTTGCATAC
GGCGCTATTGTTACCGATTTGCACAAT

Sequences in the Contig:

SY0AAA45YB17FM1 SY0AAA55YJ13FM1 SY0AAC14YG07FM1
SY0AAD29YP06FM1