Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3705
Length(NT) : 2067
Best Gene Model Blast : Link to GSTUMT00007380001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein An08g04110
Accession: ref|XP_001392527.1| Score: 499 E_value: 4e-48
KEGG Definition: hypothetical protein
Accession: ang:An08g04110 Score: 499 E_value: 2e-48
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2913 Score: 361 E_value: 9e-35
PFAM Definition: PQ-loop, PQ loop repeat. Members of this family are all membrane bound proteins possessing a pair of repeats each spanning two transmembrane helices connected by a loop. The PQ motif found on loop 2 is critical for the localisation of cystinosin to lysosomes. However, the PQ motif appears not to be a general lysosome-targeting motif. It is thought likely to possess a more general function. Most probably this involves a glutamine residue..
Pfam Number: pfam04193 Score: 140 E_value: 4e-09
Swissprot: Q06328|YD352_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology

Sequence:
>Contig3705
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTGTTATACTAGCCTTTCC
TCTCCCCCTTTCTCCTATTCATACCATACATTTTTATTTCTACCCTCCTC
CCACTTATTGTGCTCTCTACTCGTATTGATCTTGTTCTGCATCCAAGACT
CCGTAATCCCTTTGGTCTCGGTGGTGAGACGTGCACAGGATCGGTGTAGA
AGCAGTGCGACTACGCCTCCTGTAGTTTGTATCCGCTCGTCTTCGCCTCA
GTGGTCTCGCGCCACGAGACAGCTTGACATTCTCGGGACCCTGCCCAGGG
TTTCTAGAGTTGAGACTCTTGGGAGAATTTTTGAGCCCCGTGTGCTATTT
CCTCTTCTGAAGTGAAGAAGACCCTGTCTCATGTTCGAGGTTTTACGTAA
ACCAGGTCCCCAGAAACTAGGGCCCTTTTCTACCAGGGAATAGAAAACAC
CGCCTCCGAGAGAGCCTGGATCTTGCACTTTGCATCTTTGCAACTGTGAG
TTAGGCTTGGGCTGTTTGCCCCTCTTTGTTAGATCGGATCCTGTCGGATC
GAACATTATCCGCGGGGTTCAGCGCCGCCTGTTGTCGGTTCACGGTGGTT
TTTCGTCGCTCGCTCCTTTCTATTTTTCATCTTCACGGTATTTGACTACC
TCTGGAAATTTCGGCTTCCTTTTCACCTCTATCTGCACCGGCGGTTTGAA
AATCTACATTTGGGGCATCACAAGTGTTTTCCCTGTTCAGTGCCGCCGGG
ACTTGAATCTATAATTTGCTCGCTATATAGCTAGTCGGTTCGGGTGTTTG
GTTACCATATTGTCGGAGGGACCTGGTGCAATACACGGTGCGAGAATTTA
TCGTCGATCGTAACTGTTACCGATACAGCTTGGTTGGATTTCGAGAAATT
TGTGGCTTTCAGGCAGCTATGTTACCGCCCCATTGTGAGCCCCGAGGGGC
TTTCCTTACTACTATTTCCTCCGTCTTCGGGACATGTATCCCTTCAGCTA
TAAGTTTCGTCTCAACCGTTTTCGGAACGTTATCAATGATGTCTTGGCTG
TGCGCCCAGATACCGCAGGTACATAAAAACTACCTCAACCAGTCGGCGGA
AGGCTTGTCGTGGGCATTTATGGCGATTTGGCTGGCTGGTGATATATGCA
ATTTCACGGGTGCGGTACTCCTCCATCAACAGCCTTTTCAGATTGCTATA
GCCGCGTATTACATTCTCATAGACACGGTCTTGGTGTTCCAACTTTACTA
TTACGGATTTGGGTCAGAAAGACTCGATCGACGTGCTCCTGTGATTAAGA
AAAGTGAGAGCGAGGTTGGGGAGGATAATACCCGGACCCCGTCTCTATAC
AGCTATGGGACCAATCAGAATCCTAACCTCGATGGATCGAGGGATAGAGT
AAGAGTAGCAAGAACACATTGTGACAACCGTAGCTTTCGGACCATAGTCT
TTGGGTCATTGGCATTGCTTTCATCCCGCGCACACGCCGCACCTATAGGA
ACCCAGGCCCCTCTCGCAGAGGTTGATATAGGCCAGATCTTGAGCTGGAC
AAGTTGCATACTGTTAGTAGTCTAAGCCCTGAATTCCTCCAGGTATCGAC
CCTAACCCCGACACAGATATTTCTCCTCCCGAATCCCCCAAATCTTGAAG
AACCATTCCCGCAAATCAACTGACGGCCTCTCACCAATCCTCTTCATGGC
TGCTTTCTCGGGAAATTTCTTCTATTCCGCGAGTCTGATCATTAACCCGC
TTGGCTGGAACGACTATCCCGCCTACGGAGGCGGTGGGCTTGCAGGCCCG
GATGGCAGTGTCGCGGACGAATGGTGGAGCAGAACACTCCCGTTCTTCCT
GGGGGCCTGGAGCGTGGTTATCATGGATGCCATTGTTGGGCTACAATTCT
ACCGATGGCCGCCGAAGAAGGACGAGTTAGAGGTAGTAGGAGCGCAGGTA
GAGGATGAGAGACAAGGATTGCTCTCCGAGGTAGAGAGCTCGTATAATGA
TACCGGAACTGGTTAGAATTGGAGTTGGGGGGTTTTGTCTTTTTTCTTTC
AGAGAATTCATTTTGCT

Sequences in the Contig:

SY0AAA11YJ12FM1 SY0AAB31YA11FM1 SY0AAB43YM04FM1
SY0AAC14YF21FM1 SY0AAC56YM07FM1 SY0AAD1YM01FM1
SY0AAD25YJ20FM1 SY0AAD28YA22FM1 SY0AAD34YH20FM1