Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3704
Length(NT) : 972
Best Gene Model Blast : Link to GSTUMT00008844001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57356.1| Score: 832 E_value: 4e-87
KEGG Definition: amidases
Accession: aor:AO090003000129 Score: 832 E_value: 2e-87
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis, Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1212 Score: 636 E_value: 5e-67
PFAM Definition: Amidase, Amidase..
Pfam Number: pfam01425 Score: 552 E_value: 3e-57
Swissprot: P08158|AMDS_EMENI
Gene Ontology:
GO:0004040 = Molecular function: amidase activity

Sequence:
>Contig3704
TTGGGGAAATCAATCGCCGAAGCCAAAAATGCAGAAACGAAGGCGAAGAT
TCCGCGGGAATGGCTAATCCCCCTCCCCCCCGCTGAAATTCGCGATGTCA
CGGGGTACGCCAGCCAATTCTTGACCCCGGCAGAGATAGCAATCACCGAG
AGCACGGCACATGAGCTGGTGGGCAAGCTAGCCTATGGAAAGTACTCTTC
TCTCGAGGTCACCAAGGCTTTCTGTCATCGTGCCACTATTGCCCACCAAT
TGACAAACTGCCTCATGGAGATATTCTTCGACAAAGCGTTCAAAAGAGCA
CAGGAGCTGGATGACTACTTCCACGAGTACAAAAAGATCTCGGGGCCGCT
TCATGGCTTGCCCGTATCGTTGAAGGATAGTGTGAGGATTGAGGGCGAGC
AGACTACCATTGGGTATGTTGGGTGGATAGGGAAGAATGATACTTCTGAG
AGCGAGGCGCTGGTAACCAAGATACTGAGGAATGCTGGTGCTGTGTTTTA
CGTCAAGACTAGTGTGCCGAGTGGGTTGATGAGTGGGGAGACTGTGAACA
ATATCGTGGGGTATACTTGGAATCCGAAAAACAGGCTTTTGTCTTCCGGC
GGCTCGTCGGGGGGAGAAGGTGCATTGATTGCGATTCGGGGGAGTCCAAT
GGGCGTTGGAAGTGATCTTGCTGGTTCAATACGCATCCCGGCAGGAGCAA
CTGGCATATTCGGCTTGAAGCCTTCCTGTGGCAGGCTTCCCTATAAAAAC
ATCGCCCAAAGCCCGAACGGACAAGAGACAGTCGGCGGGGTAGTGGGTCC
AATGACCAACTCAATCGCAGATGCTCGACTCTTCGTTCAAACAATTCTGG
AAGCAGAACCCTGGAAACATGATCCCGGAGTAATCGAGTTGAAATGGAGA
CCTTTGGAAGAAGACGAGACACGTGAGCACGCAAAGAGGGGACTATCCTT
TGCAGTCATGAAACACAACGGA

Sequences in the Contig:

SY0AAC14YF19FM1 SY0AAC37YM17FM1