Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3703
Length(NT) : 1385
Best Gene Model Blast : Link to GSTUMT00010884001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein An11g00410
Accession: ref|XP_001394045.1| Score: 637 E_value: 3e-64
KEGG Definition: hypothetical protein
Accession: ang:An11g00410 Score: 637 E_value: 1e-64
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4761 Score: 185 E_value: 2e-14
PFAM Definition: PI31_Prot_Reg, PI31 proteasome regulator. PI31 is a cellular regulator of proteasome formation and of proteasome-mediated antigen processing..
Pfam Number: pfam08577 Score: 209 E_value: 3e-17

Sequence:
>Contig3703
TTGGCCAACTTTTTTGTACAAAGTTGTCCCAACTAGCCCAAGCCATCGTC
ATTGTTTCGTCTGGCTTCACCCGAAAGAAAATCCAATCATCACCACAGGC
TTTGTTAACCCAGATTCATATTTCATCATGGCTGAGATTCCCTTTAGCCC
GCCTACTGTTCTGAATATCGTAAAGGCGAGCTTTCCGCAAGGTCCTGGGA
CGGTACCTTCTCTGAAATCACCCTATGATGCTGTTGCGATATTCGTCCAC
GCGTGTATGCTGTCAGTGGGGTTTCGACTGGTGGGGTTGGGTGAGGATGA
CAGCCTGGAAACACCCATCGAGGGCTCGGATCCAAAACCACTTCCACAAA
GCTGGAACAGCTCTCCTGGTAGCTACGGCTTCCGATATGCGCACTCACAA
TCGTCTTTACAATACCTGATAAAGGTGAACCGTCTAGGGAACAAAGCTGT
AGTAATGGGTTTGGGAATCGGCGACGATAAGACTACCTCTTTCGACATTG
TCGTAAAGGACTTTCTTAGCGAGAGCTTCTACCCGTACTCCGCTGGAAAT
GGCGTAGCGAAGCTGGAAGACGGGTTTATCAGCGCAAGCAGAGCGCAGGA
CCTGGCCAACTTGGTCAAGATTAATATGGTGCAGAAGTTGGTTCCAGGAT
TGCACAAACCAGGCTACGAAGAAGACCGCAGCGGGGGAAGCTCAACCCGT
CAAGAGGAACAGCGACCCAGGCGGCGGTCAGACGAGTTTGACCAACCAAG
TTTCCCAAGACCATACGGCGGTTCGGGCTTCGGCCCGCAGCCCGGCCGGT
CTCCTATCCCAGCGGGTGGCGAGCAACCTCCAGGGTTCGACGATGAGCAT
GAAATTCTCCAACCACCGCGCGGCAGCGGTGGATATGCCATGGGCCCCGG
GGGCCGAAACCCATTGAGTATCGGGGAAGACGACTTGAACCCTCCAGGCC
TTGGCCGGAACCCCCCGCTCGTCGGTCCATTCTTTGGCCAGGGTCCTGGA
TGGGGTGGGTCTGGACCGAGCGGAATGCACCCGGGACCAGACCATCCAAT
GTTCGGCGGTGGCAGTGGGGGAATTCCCGATCCAAGGTTTCCGCCTGGGG
CGCGATACGATCCAGTTGGCCCCGGCGATGCTCCGCAGGGAGGTTTGCGG
GGACCTAGAGGACCGTTTGGGCCTAGTGGAACTGGGGGTCCGCGAGGGTT
TGGTGGAGGGCCACCGAATCCATTTTTGTCTTTTGGGGATGGCGATTTTC
TTTAGTTTTCCTTTGTGTAGTTGGGCTTTTGAGACTGCAATGGGATTGAT
GGCAGAAATGTATTTTAGTTTTTTCCATGAGGGAATGATGTGGTTTTGAT
GTGAAGTTAGTAACTTTTCATTGGCATTTTGCTTG

Sequences in the Contig:

SY0AAA10YB05FM1 SY0AAB5YD24FM1 SY0AAC14YF10FM1
SY0AAC20YL21FM1 SY0AAC28YG11FM1 SY0AAC32YM13RM1
SY0AAC39YO05FM1 SY0AAC4YL09FM1 SY0AAC54YD17FM1
SY0AAC60YH23FM1 SY0AAC7YD10FM1 SY0AAD12YD18FM1
SY0AAD34YP21FM1 SY0AAD38YH21FM1 SY0AAD39YH19FM1
SY0AAD57YL06FM1 SY0AAD59YK24FM1 SY0AAD5YJ21FM1
SY0AAD61YG03FM1