Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3702
Length(NT) : 1199
Best Gene Model Blast : Link to GSTUMT00001745001 E-value : 1e-120
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3702
TTGGCGATTACTGGCCATTGGAGAAATAACATGCCGACGCCGCCGCCCTC
CCAATAGAAGTGTCACTTGGACGGGGGATTTTCCCCGGAGCTTTGGAAAA
ATGCGAAGGATCTTGCGACGCCATAGAATGCGCGAGTAGTAATAACTCCT
AGACCCCTCAGCGCGACCAACTAGAGGAGCACGCAAAGTCATGGCCGCTC
ACTCGAGGTATGCTAAACTAATGCAGTCCAGATAAGCATCTCGCTGAGCT
GGCTGATGATCGATAAGGGGAAAGCGATAGAAAAAATCGCGCTCTCCGAG
TGATCATTTTATCGCCAAGAAATACTATCTTGCGGCCTTACTTTTGGATC
GGGCGCCAACACCACGCTTGGGATAACTTTATTTATGCGCTGGGTTTCAG
TGAGAATGTGCTGGTGAGGGGTTGTGCGGCGAATATTTTTGGACAGCCCG
GTACAGAGAGATTTTTTTACAGCGAAGCCCTGAGTGCTCGGTCAGCCGCC
AAGAAAGATGGGAAGGCTGCGAAATTGAATGCTGCAGGAGAGCCCTTCTT
GTTCTACGGCTGCCTTTGCTTGAGTCATCTATCGGGAGGGGTTATCACAG
TGTTCCAACCCCGCCTGTCAAATACCAACTCTGTCGCACTTTCCACGGCA
CCGCACAGATACAGTGGACACACAAATAGAACGAACAGGCACGGTACTGA
GATATGGCAAACCTACAGGCATGGCATTACGGGGCTCGAGAGGATGGTCA
CTACGCCCGGCATAGCGATGAACCAAACTCTCCAGTTTCTCCAATCTCTC
CGAGCCCATACAACACACAACTCACGCCCCCTGGGTCGGGTTATGTAGAC
GCCTCAGGATATGGCTACAACCAATCTCCACCAACACACCCGCCACCGTC
ATACCCAACCCAAGCATCAGTATGACTCCTCCCTCACACACCACCATCTC
ACGCCCCGCTAACAAGACAGGAATATCAGAGCTCGGACACCTATCTAAGC
CCTGGCGCGCGGGGCTATCTCCAGACGTTTGGGGGAACATCCGCTGCAGT
GCTTACTCACTCCCGCCCCTCTTCAGAGCACGGCAAATATCCGTACGAGA
CAAGTACCGCCACTGCCGGCGAATACCCGAACTACGACTCACGGGATCCA
CCACACAACCTCTATAACGGGGACAACTTTGTACAAAAAAGTTGGCCAA

Sequences in the Contig:

SY0AAA19YM17FM1 SY0AAC14YF08FM1 SY0AAC39YF02FM1