Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3701
Length(NT) : 989
Best Gene Model Blast : Link to GSTUMT00004558001 E-value : 0.0
Numbers of ESTs : 69

Blast Results:

Nr Definition: putative O-methyltransferase
Accession: gb|AAP31249.1| Score: 302 E_value: 1e-25
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04557 Score: 280 E_value: 2e-23
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1663 Score: 288 E_value: 1e-26
PFAM Definition: Methyltransf_3, O-methyltransferase. Members of this family are O-methyltransferases. The family includes catechol o-methyltransferase, caffeoyl-CoA O-methyltransferase and a family of bacterial O-methyltransferases that may be involved in antibiotic production..
Pfam Number: pfam01596 Score: 291 E_value: 5e-27
Swissprot: Q00719|MDMC_STRMY

Sequence:
>Contig3701
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCCATTTCCCTCCCAGCT
CTGCCATTGGCGGTTGGAACCTTCACAAAGGAAAGAACACAAACCTCTAC
ATACCTTTTTGGAAGCCCCCCGGATCCCAAGCAAAAATGTACACAGCAAC
AGAACTCTACCCAAATGAGCACGTCACCAGGGCCGTTCACGAATACTGTA
TTGCTCATTCCACGCCCTTGCCAGGCGTCGTGGACCAGCACCGTACAAAG
TCTATTGATTTTGCACGTTCAGTTGGAATGGATCCTTACATGATGGTTAA
TACACTTCAGGCTCAATTTATGCTTTTTTTCGCAAAGTTGATTGGGGCCA
AGAAGGTGCTCGAGGTTGGGACTTTTACCGGGTATTCGGCATTGGCTTGG
GCGGAAGCTATCAAAGGGCAGGAGGGTGCCAAGCTCGTGTGCTGTGACAC
CCCCGGCCCCCACACCGAATTTGCTAAGGCGGCCCTACTCGAAGCCGGGT
TTCCCGACACATTCGTTACTTTCCTCGAGGGCGACGGCGTCGAGAGCGTG
AAATCTCTCCCCGCGGACCAATTCGACATAATCTTCCTCGACGCCAACAA
AAACGGTTACCTTCCCGCGGTTGAAACAATCCTCTCCCGAAACCTCCTTT
CTCCCCGCGGCGTCGTGATCGCTGATAACGCCCTCAGGCAAGGGCTCGTC
GCGGATGATACGGAGAAGAACCCTAATTCGTTTGAGTTGGACAGCACGAG
CGTCGCTAGCTATAAGTATATTGATGAGTTCAACAAGTTTGTGAGGGATC
ACGAGCAGTTGGAGCAGGTTATGTTGCCGGCTTTTGATGGGTTGAACATC
ATTCGATTGAAGCAGTAGTGGTACAGAACTGGATTGTGGCATTGATTTTT
GGACTTGTATTCTCTCCTCTCTTGTATAATGTTTTGGTGATCAGTGTGGG
CGGGTGATAGAAACCATTATACAAGTATATCCTTGTGCT

Sequences in the Contig:

SY0AAA15YI19FM1 SY0AAA18YA14FM1 SY0AAA18YK01RM1
SY0AAA34YA12FM1 SY0AAA47YM01FM1 SY0AAB14YH23FM1
SY0AAB2YH16FM1 SY0AAB32YD22FM1 SY0AAB46YD07FM1
SY0AAB50YA14FM1 SY0AAB52YO16FM1 SY0AAB57YB13FM1
SY0AAB57YJ02FM1 SY0AAC11YM14FM1 SY0AAC14YF01FM1
SY0AAC15YK02FM1 SY0AAC20YH07RM1 SY0AAC20YK21RM1
SY0AAC28YF15FM1 SY0AAC28YF15RM1 SY0AAC29YH22FM1
SY0AAC31YB21FM1 SY0AAC38YH11FM1 SY0AAC39YO22FM1
SY0AAC46YH08FM1 SY0AAC49YE09FM1 SY0AAC49YH06FM1
SY0AAC50YO21FM1 SY0AAC51YN11FM1 SY0AAC57YK21FM1
SY0AAC5YK05FM1 SY0AAC60YM16FM1 SY0AAC61YL05FM1
SY0AAD11YG13FM1 SY0AAD14YB17FM1 SY0AAD15YJ06FM1
SY0AAD19YN13FM1 SY0AAD22YI02FM1 SY0AAD26YM24FM1
SY0AAD27YI13FM1 SY0AAD29YF08FM1 SY0AAD31YC20FM1
SY0AAD33YB18FM1 SY0AAD33YL06FM1 SY0AAD34YI05FM1
SY0AAD38YE12FM1 SY0AAD38YI03FM1 SY0AAD38YJ11FM1
SY0AAD38YL15FM1 SY0AAD38YO10FM1 SY0AAD3YK03FM1
SY0AAD41YB22FM1 SY0AAD42YG14FM1 SY0AAD42YI24FM1
SY0AAD43YB23FM1 SY0AAD43YG02FM1 SY0AAD48YM10FM1
SY0AAD49YP19FM1 SY0AAD4YO08FM1 SY0AAD55YB21FM1
SY0AAD56YD04FM1 SY0AAD57YF11FM1 SY0AAD57YK02FM1
SY0AAD58YK12FM1 SY0AAD61YF18FM1 SY0AAD62YH02FM1
SY0AAD63YE12FM1 SY0AAD6YB20FM1 SY0AAD6YO19FM1