Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3700
Length(NT) : 918
Best Gene Model Blast : Link to GSTUMT00000084001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_09574
Accession: ref|XP_001799863.1| Score: 331 E_value: 4e-29
KEGG Definition: hypothetical protein
Accession: ang:An07g05090 Score: 255 E_value: 1e-20
KOG Definition:
Classification: [RNA processing and modification, Transcription].
Kog Number: KOG0132 Score: 138 E_value: 2e-09
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 134 E_value: 7e-09

Sequence:
>Contig3700
TTGGCCTCAACCCTCCTATCAGTCTCACAACTCTGTGCCTAAACATCTCC
ACCCGATCCCTACCCCTCCGCTCCCCTCCCTCTCAAATAGCTGCATGTTT
TTTTAGCGTCGAAATTGTACTTCTATAGACCTTCTCCGGAACCATGGGAG
ACCATCAACAAAACCAGCGGATGTACCGGCCTCCTTACAGTCATACTCCG
GCTTCGCAGCGTGATGCTGCTTTCTCAAATATTTTTGGCACTGCTCCGTC
AGGCCGTTCTCAGACTATGACATCTCAATCAGCTATCTCGCCGTTAAGTG
GGCGTTCACAAACAATGTCCTCCCAGTCGGGAATGTCCGGATACATCAGT
TCATCTCGTCAACAGCTGCAAGGATATCCACCTAATCAGCAAGCTCCCCC
TAATGCTTATCATCATCCGCAATCCAACCCCAGTTCTAGAGGGCAATACC
AACCCCAGAATTTACCTCAGCCTATGCACCCTGAACGGAGACCATATGCC
CAGCCAATGCGTGTTCAACCCCCCGGAGCTCCCCCCCCTAACCCAAACAT
GTCAAAGCCAGCTCCCCACAGGTATTATCCACCTCCGCCTGCTCTAAATG
CAGATCCATGTCGTTCCAGGTCCATGGCAGCAACGTACTCACCTTCCGGT
GGACCGTCGGGACCACATTTCTCTCGTCCTGGAGCTGGACTGCCGGGACC
TCATATGTCTAGAACTACGGCACAGGGAAGGATCGTGCCGGAGAGGCATG
ACGAGCGGACCATGTCACTGACCACATACCCTCATGATCGGGATTTTTCT
CAAACCGCGAGCGGGCGAGTTATCCCTCACCGGCGAAAGGATTCTCAGGA
AAGCCAGTATAGTCAAACCAGTCAGTATCGACGACAACCAGAACAACAGC
GGTTTAACACTATGCCAA

Sequences in the Contig:

SY0AAC14YE21FM1 SY0AAC4YI22FM1