Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig370
Length(NT) : 1025
Best Gene Model Blast : Link to GSTUMT00005338001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_08488
Accession: ref|XP_001590748.1| Score: 511 E_value: 7e-50
KEGG Definition: exocyst complex subunit
Accession: aor:AO090023000477 Score: 494 E_value: 3e-48
KOG Definition: No Hit Found
PFAM Definition: Vps51, Vps51/Vps67. This family includes a presumed domain found in a number of components of vesicular transport. The VFT tethering complex (also known as GARP complex, Golgi associated retrograde protein complex, Vps53 tethering complex) is a conserved eukaryotic docking complex which is involved recycling of proteins from endosomes to the late Golgi. Vps51 (also known as Vps67) is a subunit of VFT and interacts with the SNARE Tlg1. Cog1_N is the N-terminus of the Cog1 subunit of the eight-unit Conserved Oligomeric Golgi (COG) complex that participates in retrograde vesicular transport and is required to maintain normal Golgi structure and function. The subunits are located in two lobes and Cog1 serves to bind the two lobes together probably via the highly conserved N-terminal domain of approximately 85 residues..
Pfam Number: pfam08700 Score: 191 E_value: 2e-15
Swissprot: Q5BFX0|EXO84_EMENI

Sequence:
>Contig370
TTGGGCGCGAGATCTCATTCTAATTCCTCCTCAACTTAGAAAACCCCAGA
ATCTTGTCCCGGGAGTGTCATTGTTCTGCTGTAAATACCAGCAGTTTGGA
CCATAAGTTAGACTACGGTAGTCTGGAAACCCAACAATTATCTCCCCCTG
CCCCTTCCCTCCACTCCTATTACAACCACAACCAGAGTCACGAATCACCA
ACAATATTACAGAATGGATAAAGATCGATCTAAAGGCCTGTCCCTTCGAA
AGAAGCGGAGCGAAGGCAAACGCTCGGCGAAGCCAGTCATCGGTCCACCA
CGACAGGTCCCCATGCCCCCAATGCCGGGTGCGAAGCTTGGACCAGCTTC
AGGGCCTCCGCAGGTTCGTGTTAGAGACAAACAAATGGTTGCAGATCTTG
TCAAACGACGAATGTCTACACGGTTTCCGATGCCTAGTGAACCGGGTGCT
AATATCCCAGCCATGCCAAACTTGCCATCGGGACCAAACATGATTGCAGC
TGGGGCTGGTGCACGACTCCCTGTGAAGCAACCTGAACGATCTGATGGGG
TGAATCTTGACTTGGATACCTTTCGTGATCCAAACTTTAATCCAGATGCA
TTTGTCGCCACGGTCTTGGCCAATGCTTCAGATGAGGAAATCCGAGACTA
CCAACGCCGCCTCAAGGACATCCGTAACCGTACCTCTTCCGATTTACAGA
AAAATGTGTTCGTGAACCGAACACAGTTTATCCTTATCTCAAAAGAAATT
GATAAGCTCAAGAGTGAGATGCGTGTTCTGCGGAACCTACTAAACGATCT
ACACAACACCACTAGTTCGCTCAAAACGGACTCCGAGAATTCAAGTACCA
CAAGTGATCTCAAAGCTAGAAAGGCAGCGAATAGGAGTAGTGTGGCTGAT
CTCACTGCCTTACATATGAGCCATCTTCAAGCTTTGTGGAAACAAGTTGA
AGGGGCACAAAAGTTCCTCCCATCAGTTCCCGGGAGGCATATCATCTTGG
AATCCCGGCACTGGGTTGAGTTAAA

Sequences in the Contig:

SY0AAA20YF15FM1 SY0AAA22YD19FM1 SY0AAA3YB07FM1
SY0AAA45YA23FM1 SY0AAD20YG01FM1