Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig37
Length(NT) : 726
Best Gene Model Blast : Link to GSTUMT00005211001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: transcriptional repressor Sak1
Accession: ref|NP_594086.1| Score: 381 E_value: 5e-35
KEGG Definition: sak1; hypothetical protein; K09175 regulatory factor X, other
Accession: spo:SPAC3G9.14 Score: 381 E_value: 2e-35
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3712 Score: 202 E_value: 6e-17
PFAM Definition: No Hit Found
Swissprot: P48383|SAK1_SCHPO
Gene Ontology:
GO:0000785 = Cellular component: chromatin
GO:0005634 = Cellular component: nucleus
GO:0003677 = Molecular function: DNA binding
GO:0031536 = Biological process: positive regulation of exit from mitosis
GO:0007346 = Biological process: regulation of mitotic cell cycle

Sequence:
>Contig37
ATCGATGCAAAGATCGTGCCATCTAGCATATTTTCCAGTCTCTTAGACCG
ATTGCTGCGCGTAAACGACGCCGCGCACGCAGCAGCTAGGTTTCTCGGAA
ATCCTCCCGATAGAGAGCAAATGGTCAAAGACTGGAAAGACTATGTCAAC
GCACAAACAATCGTGGACCGTGAATTGCCCTGTGGCTCTGCAACAGTGAG
AGAAATCTTGCAAACTGAGGTTATCACCCTATTACAGCCACCTTCGACAT
CTGTGAATGGAATCCCCGAAGTAGAAGATGGCTCAGCATCCACGGAAAGT
GTCCTAGACCGGTGGACACAATTCCTAACTTACCTCCCTCACCGATTCCC
GGGAACAGACCCACGACTTTTCAACTTGTGCCTTGGTGCCGCAGCATCTG
CGGCCCTACGGGATTTAACAACCAATGGTGCTGTATCATTCGGCAGCTGG
TGGGTCGTCCGTTGCTGGGTAGACGAATGGATGGGGTGGCTGGCCGAGCG
AGGCGGATTCCTTCGCCATTCTTCGGAATCATCGATACACATTGGTGGCG
GTCATGTAGGTGCTGAGGAGGAACGTGTCTCTGTCGAGGCGGACTTGATC
GATAATGGGGACGAGCTTGGTCACGATGATAGTGGTATATCTTTACGAGG
AGGGGAGGAACCAATACATCTTCTGGATGAGGTAGGGGATGATCGGGATA
ATAGGATGGTCACTATCAAGTTTAGC

Sequences in the Contig:

SY0AAA11YG20FM1 SY0AAA2YA10FM1