Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig357
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00001690001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN8743.2
Accession: ref|XP_682012.1| Score: 363 E_value: 6e-33
KEGG Definition: hypothetical protein
Accession: ani:AN8743.2 Score: 363 E_value: 3e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig357
TTGGATCTGATCCCCCCACAAGACTGTCCCCCTCCTCCCCCCCGCTTACA
ACCACCATCCTCTCCTGGCTTCCAGATTAGATATCGTGATATTGGGATGT
CACCAACAGCACCAGCTGCGGAAGAAGAACCTCCACCCGCCTCTTCCACA
GCTTCCACTAATGTTGTAATGTCAACTCCGCACCCCGCTTCTGGTCCTAC
CCTGCTGCCAGCACCAGTTGCCTCGCTAGTTTCGCTGATATCGAGATCGA
CGACTGCGTCTATTCGGCTAGGGTCGATTATCGGCGGGACAATTCTCGAC
TCGGCACGGCTTGGGACACTTACGGGGTTGGAGATTGGGAGAGCTGCTGC
GGAGGGAATTTTGGCTAGAGCAGGGAGGGATGTCCGGGATGATGGATGGG
CTGATAGAAGCATAAACTTTGTCAGATCGTCAATATCACTCACGCAGCTT
CTACTATCTACCGGCTTCGAAATCGGCTTGACCACACTTACTACTGTTAG
TGGCCTTGCGGAAACCTACGTTCTCACCCTTGATTCTATATTCGGAAGCA
CGGAGAGTTCGCGGGCAATTTCCGCGATCGTAGCATTGATTAAGAAGGAA
ATTGAGGAGAATGAAGCGGGGGAAGGAAAGGTTGGAGTGAGCGATTTGGT
GATTGGATTGTCTTGCTTTGCTATACTGCAGATGAAGACTAAGAAGAGGA
GGGAGCTTGAGATTAAGATGGACTTGGAATGGGATGA

Sequences in the Contig:

SY0AAA14YN24FM1 SY0AAA22YA10FM1 SY0AAC57YG20FM1