Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig356
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00000577001 E-value : 9e-98
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 105 E_value: 9e-06

Sequence:
>Contig356
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAAAAAAAAATACTCACTC
AAAAGTTCTTTATAAAATATACCCCCTACCCCACGATTAAGATAGTTATC
ATGGACGTTTAGTTCCTCTCCCCGATACAACCTCAAACCTCGTTTTCCCA
CGCTTGTACCCCTGTAGAATCCTTCACCACGCCTTCCCCAGAGATCTACG
GACCTCTGAGCCCTTCGCTTAGCGACATTACCCCACAACAGCCAGTCACC
ATTCTTCCCTCGGAACCATTGTGTTTCCCTCCAAACGACCAGCCATGGCC
CTCCACAACCCCTCACCAGAGGCTTTCGCCGCAAGTACTAGCCTCAGACT
CGCTTCCACCGCTGCCCCCGACTCCCAGGTCACCAGCCGTTGCTCATTTC
GACAGAACCAGCGCTCACGACAACCAGATCAGTTTCGACGATCCCGTGCT
CTTTCCTCAGCGAGCGCAACCATCCCCGCGTACTCTCCCTAATCAGCTGC
AACAGTCGCAACAACAATCACGCACTGCTCAACCCCCGCAACCGCGAAGA
GTAAGCGAGATTGTTCACGGTCTCGGATACACTACAACGACGTCTTCGTT
CA

Sequences in the Contig:

SY0AAA22YA09FM1 SY0AAA26YG10FM1 SY0AAA44YA05FM1
SY0AAA46YM24FM1 SY0AAA54YD13FM1 SY0AAB34YP24FM1
SY0AAB42YE24FM1 SY0AAB8YF08FM1