Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3525
Length(NT) : 1939
Best Gene Model Blast : Link to GSTUMT00011116001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3525
TTGGCTCCTCCCTCGCCCTTCTCTCACCCTGCCCTCCTCACCCTTCCCTC
CTCACCCTTCCCTCACCCTACTCTCACGGCTCAGCTTCTTCAACTTTCCG
CAGGTGAATGCCCCAGCCAGGTGATGCCTAACAGACTGAGGTATTCCCGC
TTCTTCAAAGAGATCAAGCACCCACGGGACTGGGGAATCGTCGAATACTT
GAACTACGACCACGGCAAACTCCCACCGCGCAAAGTGCTTGACGGGTGGC
AAAAATCGCTGCAGGCGATTATTGGATCTGCCGACGAGGAGTTTTCGCAG
TCACAGCGGAAGCGTGCGGCGGAGTTGCTCAAGCGGTATAAAGAAAAGGG
CAAAGGATCCGACCGTCTTGCCGGCCGTGAGTGGCTTTCGGGTCAGACGA
GACGACAACAGAAGCCATCACCAGTAAACATTGGAGCTGTTTTCAATGGC
GCTGTGACAAGCTCATCGGTCCCCATCACTCAGACGACCGGTTCACACCC
ATCGCAAACCGATGAAGTAGAAGATGGTGATGCAGCGACAGGCTCTCCTG
TTGAAGGTGACACGGGAGACGAGGAATATGATGATGAAGATTGTGAAACC
CCTACGCCCGAACAACCTCGTGAGAACCGCTCGATCCCGGCCTCCTTTTA
CAATGCCTACAATGAGATGGCTTCCGACCGCAAATGGGTGCTTGCTAGCG
GTCGCGCCGTTGAAGATGTCATCTTTGAAGCTTGCACAGCTATGAACACC
GCGACATTTGCTCACTCTCTTTCCCAATCGTTCATGCTTGATACATCAGA
TCCTGTTATGAAGAGCTGGTTCACGGCAGATGAATGGAATGAGATAATCG
CGAACGTATTGCCCTTACCAAAGCCAGATGTAGTGCTAGCGGATTCCTTG
AGAAGATTTTTTCCCGTGAAATCCACAACCATGCTACGAGAGGTCCTGGA
CAAGCAAGGCTATTTACCTAAGGGCGTTAGCTACGATAGCAAGGTTCATT
ATAATTCACAATGGGCTGATGTGGTTATTCGCAGATTTCAAATGCTCCTC
GACGCCCCCGGTGAGCCACTTCGCGCACCACACCTGGAAGACTGGTACAG
CTCCTATGTCTGGTCCTCAATTCTCGATGACTCCCTCCTAAACCTCCCCG
GCATGACGGTAGAGCGCAAGGAATCCCCCTGTCGTGCCACCTCCCTGCGC
AAGAACCGCCACCGGCAAAAGCTCTCGACAAGGATGAAACTCGGCTCACG
CCTTGATGCTATAATCCGCACATCAGAGGATGACTACTACGAGTACGGCG
CGATGGAAGTCGCGCGAACCTTCACTGGTGGCGTGACATCAACGAAGTGG
CTCGGCGACACATTCAAACTCGCTAAAGCCCTGCGCGACATGCTCTCCCG
CCTACACGACTTGGTGAAGGGCGACGAGGGTGTCACGCGACGGGTACAGG
TTGTTGGGGTTTGTACGGCGGGGTTGGCGCTGCAGTACATTCGCTTAGGG
TATCCTGGTGTTGGGCATGTGTGTTTGCTTAAGAGGGAAGGGCTGTTCCA
GGTGCCGAAGGGTGTTGGGGGGCTTGCGGAGTTGCTCAAGATGCTTATGA
CGGTTGCGCAGTTGAAGGAGGTGATCAGGTCGTCGGCTGAGGCTGTCGAG
GAGAGGCATATTGGGAAGAGTGAGGTGGATTTGTATGAGGAATTGGTTGG
AGGGAAGACAGGGGGTGGTGCGAGGTTGGGGCGGGCGATTGACACGCCGT
GACGGGTTAGGAAAGAGCGGGTATTAGCAAAACGTGATTACGTGTCGGGC
GCAAAATGAAGTTGTACTTCTCCAAAATTAGCGTCCTATGTTTGCCCCCG
TGTCCTGTTACTTAGGTTTCCCCTTTTCCCCTCCTTCCCTCTTCTCTTAG
ACTTGTCTCTAACAACCGCCAACAACTTCTCTTATTCTC

Sequences in the Contig:

SY0AAA22YC22FM1 SY0AAA24YF06FM1 SY0AAA24YF06FM2
SY0AAA25YB03FM1 SY0AAA37YB24FM1 SY0AAA3YD11FM1
SY0AAA45YD07FM1 SY0AAA47YN02FM1 SY0AAA49YC15FM1
SY0AAA4YJ10FM1 SY0AAA57YK06FM1 SY0AAA5YL02FM1
SY0AAA62YJ16FM1 SY0AAB11YC19FM1 SY0AAB13YI19FM1
SY0AAB17YP21FM1 SY0AAB1YM06FM1 SY0AAB23YH15FM1
SY0AAB25YC21FM1 SY0AAB33YN05FM1 SY0AAB46YL23FM1
SY0AAB50YM16FM1 SY0AAB52YB23FM1 SY0AAB58YB23FM1
SY0AAB59YM03FM1 SY0AAB8YA05FM1 SY0AAC29YD13FM1
SY0AAC31YM06FM1 SY0AAC31YM06RM1 SY0AAC42YE08FM1
SY0AAC54YB18FM1 SY0AAD16YF10FM1 SY0AAD16YO23FM1
SY0AAD30YJ05FM1 SY0AAD46YN15FM1 SY0AAD49YO23FM1