Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3489
Length(NT) : 1128
Best Gene Model Blast : Link to GSTUMT00009120001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65325.1| Score: 519 E_value: 9e-51
KEGG Definition: predicted protein
Accession: aor:AO090011000890 Score: 519 E_value: 5e-51
KOG Definition: No Hit Found
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 182 E_value: 3e-14
Swissprot: Q9UTN0|YII3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>Contig3489
TTGGGTGTCATGTCACTGGACGATAACGACGCGGTCCTTAAGGAGCATCT
GCATATGTCGACAGGCAGGGGTTTGGATTTGAGTAGTTATGTCAAACGAT
ATTGCGATTTAGCGATGAGATGCCTTGTTGCAGATCGGTTCATGGAGAGC
TATCGCCTCAGCACTATCCAATGTTTGATTTTACTAATTTATTCAAAGAA
TCATTCTAACGATGGGGGCATGAGTTGGGCATTACTGGGCTTGACTGCAA
ATATTGCGGCAGGGTTGGGATGTCATAAAGATGGGGCGAATCTTGGGCTG
GATCCGGTAGAAACAGAACAAAGACGACGATGCTGGGCAGCGATCCTCAT
GCTTGACGCCTTTCAAGCGTCTGCCTTCGGCAGACCGAGCATGATGAGGG
CCACCCAATTTGAGACGCGCCTGCCGTTGGATGTGAACGACGTCGACATC
ACCAGGACAGGAGTGCGGGAAGCTTCCTCACGTCCAACGCAGATGACTTA
TCTAAATCTGAAGTTTCGGCTTCTGAGCATCACCTCCAAGATATATGAAA
AGCTGTTCGGCGCAGAAAAACCGGACTATTCGACTATCGTCGAGTTGGAT
CAGGAGATTCGCAATGAGCAGAAGACCTGGCCGGGCAAGTACTCGGCCGA
CGGCCCGGAACTGAACGGGCTGAAGGCGAACGATCAAGTGCATTGGTATA
TCTTACATGGTCATCTGCACCAGATGTTCTTGCTCCTCCACCGTCCATAC
TTTCATAAATCGTCTGCGGAGAATCATCCTGTCGCTCCGGACTCAAGAAG
GCAATGTATTGAATCTGCGACATCGATTTTAGAAATATACAACATCCTTA
ATACGAAGCGGAAGTACCAACCTTACAGATGGTACATCAATGGCCTAGCA
ACCTTCCACGCGTTCCACGCCGTGATAGTGGTATCCGTAGATCTCCTGTC
AATGCATGATCCAAGTCAGTCATCAACCTGGGAGGCCTTCAAACAGGTAC
ACGACCATTTTAGCAAGAACGCACCTAGGAGCTCGATCGCTACAAAGACC
TTGCCAGTCGTAAACTTCCTTCGCAAAAAAATAACCGGCCGCATAAAAGC
TGTCACCCCCCCACCACCGCCAGTAGCA

Sequences in the Contig:

SY0AAB3YM24FM1 SY0AAB61YP06FM1 SY0AAC9YJ07FM1
SY0AAD48YF24FM1