Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3409
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00001304001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN7866.2
Accession: ref|XP_681135.1| Score: 486 E_value: 2e-47
KEGG Definition: hypothetical protein
Accession: ani:AN7866.2 Score: 486 E_value: 1e-47
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 238 E_value: 4e-21
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 233 E_value: 1e-20
Swissprot: O65413|STP12_ARATH

Sequence:
>Contig3409
TTGGAGATTAGTTCGTCAATTCATAATATTCGGTCATGGATGCCAATCCT
GCTTCGTTGTCTGGGGAAGACGTCAAAGGAGCTTCTTCAGGGCAACTCGA
CCTTGATGTCACTCAACACACGCTTTTTGAGGAGGCGAACCGATACGATC
ACAATCAGACATTCAGAGAGGCGCTCAGAGATGAGAAGGGAGTTCTACTC
TGGGCAGGTGTGATGGGCGCTGCCGCATTGAGTTGGGGATTTGATGCTCA
AGTAAACGGGGCAGCAATCTCGGTAGAGGCCTTCAGAAGAGACTTCGGGT
ATATATACGAGGGGAAGGCTGTTCTTCCGGCTAACTGGCAGACGATATTC
AACGTTACCAGCACAGTTGGTGCCTTCTTCGGAGGTCTGGCTAGCGGCTA
CATCGCTGATAGGGTAGGCCGTAAGTGGTGTGCTTGGTTGGGGTCATGGA
TACTGTGCGCGGGAATTGCTCTTGAGATCGCAGCGACGACACGTGCCGTG
TTCACTGTTGCAAAGGTAATCTTAGGAGTCGCACTCGGGTTTTATTTGTC
TGTGGCACCTGCGTACTGTTCCGAGATCTCGCCGGTTGTCCTTCGTGGTA
TCACAACCTGTGGCGTTTCACTTGCCATTGTTGTCGGCCAATTGCTTTCT
AACGTGGCTAT

Sequences in the Contig:

SY0AAA48YO04FM1 SY0AAB25YF06FM1 SY0AAB59YM12FM1