Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3252
Length(NT) : 654
Best Gene Model Blast : Link to GSTUMT00005953001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN8255.2
Accession: ref|XP_681524.1| Score: 314 E_value: 2e-27
KEGG Definition: hypothetical protein
Accession: ani:AN8255.2 Score: 314 E_value: 1e-27
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3548 Score: 200 E_value: 1e-16
PFAM Definition: No Hit Found
Swissprot: P87074|RHP9_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding
GO:0000077 = Biological process: DNA damage checkpoint
GO:0000082 = Biological process: G1/S transition of mitotic cell cycle
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig3252
TTGGACCGAGGACAGAATCGGCATATGTTGGCTTCACCTGCGTGATAGCG
AACAAGCACTCTCGCCGCGTAAAGTTCTTACAAGCCCTCGCCCTAGGAAT
TCCGTGCCTCGCGCCGCGGTGGGTCGAGGACTGCGTGAGGGCACGGCGAT
TGCTAGACTGGGATACCTATCTATTACCCGCGGGCGAGAGTGCGTACCTT
GCTGGTGCAGTCAGGTCTAGAGTTATGGAGTACGTGTCTGCTCGCGAGGC
GAGGTTCTTGGGCATGGTGGGGGCGAGGAGGAGGTTGCTACCTGGTGGGT
TGGTGGTTGTGGTTATGGGGAAGGGAGGTGCGGGGCTTGGGCGGTGGAAG
CCGTATTTATTCCTTGCGTACGCCATGGGTGCGGGAAAAGTTCTCACCGT
GCAGACCGTGGAGGCTGCGCTTGATGCACTCTCTCGGAAGCAAGACGGCG
GACTTGACAAAGAGGAGGCGGAGAAACTGGAGGAGAAAGAAGAGGGCGGC
GGTGGCGGGTGCATGCTTGTATATGTCGACGCGAGAGAGAGGAAGCATGC
CGAAAGGCTACTACACCGGTCCGGAAGGAATGTTAGGGTTGTCGATGACG
AGTGGGTTATTCAGAGCTTGATTTTGGGAAAGCTGATTGCCGGGGAGCAA
ATAA

Sequences in the Contig:

SY0AAB54YD01FM1 SY0AAC28YA23FM1