Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3125
Length(NT) : 1185
Best Gene Model Blast : Link to GSTUMT00006794001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_09918
Accession: ref|XP_365073.1| Score: 370 E_value: 2e-33
KEGG Definition: hypothetical protein
Accession: mgr:MGG_09918 Score: 370 E_value: 9e-34
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_16, Glycosyl hydrolases family 16..
Pfam Number: pfam00722 Score: 226 E_value: 2e-19
Swissprot: P53301|CRH1_YEAST
Gene Ontology:
GO:0009277 = Cellular component: fungal-type cell wall
GO:0000131 = Cellular component: incipient cellular bud site
GO:0005515 = Molecular function: protein binding
GO:0007047 = Biological process: cell wall organization and biogenesis

Sequence:
>Contig3125
TTGGACCCCATCGATAGTCAGGCTAGGTTCCATAAATACGGGATTGACTG
GACTGCCGAGAAGATTGACTGGTTGATCGATGACGTTGTCGTCCGTACCC
TTAAGCCCAGCCAGGTCAAGGGTGACTTTTACCCCCAGACTCCCATGACT
GCTAGAATCGGATCATGGGCAGGTGGAGATCCCGACAATGAGCAAGGCGT
TATTGACTGGTCCGGAGGACCAACCGATTTTACCAAGGGACCCTTTGACA
TGTTCGTCCAGAGCATCTACGTTCGGGACTACTCCACGGGAAAGGAATAC
ATCTACACTGATAAGTCTGGATCCGCCGCCTCTATCAAGTCCAACGGTGG
CAGCATAATGGGAGGGGGGGCCAACCCGGGAACCCCCAACCTGTCATCAT
CCTCGTCCGCGGCCCTATCATCTGGCTCCTCCGGCTCTTTCAACGCCCCA
TCCAACAGCGGCCGCCTCTCCTCAACAGCTAGCAAAAGCCACCCAAAAAT
CACCCTCGCCATCCTTGCAGCCACCCTCGCCGCCATCTGGTTCTACTGAA
ACCCTTTCCACAGTTACGCGTGGGGCAGATCTCACTGCCACTGGAAACTC
TACTGGACCCGCGGCACCAACAACCACTGGACCCAATCTATCTGCGAACA
CTGGTGTGCCTGTTGCTAATGGGTCTGCTAAAACCCCCATTGTTGCGGGG
ATAGCAGTGGCATTTGCAGGGGTGGTTTCTGGGTGGCTTTTGTAGATTTT
TTCATCTAGGGTTTCTATTATTAATTAACTAGGGATAGAATTTGGTTTTA
ACTTTTTCCTCCCCTTTTCATGTTTTATTTTATCGGGATGGCATGGGTGT
TTTTTCTTTTTCTTTTTCTTTTTCTTTACTCTCCTTTGTCCGTTGGCATC
CTATTTCCTATCACGAATGAAGGTTATGCATAGCGAATGATTTTTATTTT
TGCATGAGGTTTGTTTTCAATTTCCTCCTCTTGCTCTCTTTTTATTACAT
ATCCTCTCGATTGTAGTGGTTGTAGCGCACGATTATCTATGTGGGCTGTG
GCATAAATAGTGAATGTATTCTATATGATTTAAGATGAAGATAAAGATGG
GGGTTAATGTCGGGGGTTTTGGAAATCTTGGGGGACTTAGTTGCGATGTC
TGGGGTTTAATACGAAGGTGGCGAAGTTGAAGTCG

Sequences in the Contig:

SY0AAA18YE08RM1 SY0AAA48YJ18FM1 SY0AAA58YF17FM1
SY0AAB21YC06FM1 SY0AAB4YP24FM1