Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3007
Length(NT) : 794
Best Gene Model Blast : Link to GSTUMT00011125001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212451.1| Score: 403 E_value: 1e-37
KEGG Definition: hypothetical protein
Accession: ang:An06g01600 Score: 396 E_value: 5e-37
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3007
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCTTCTAACATCCTGATC
GGATTCTACGAATGCATCAAGAAACGTAGGGGATATTCCCGCGGCGCAGC
CATTCGTCAGCCCGCATTTTCCTTCCATGGCTTATCTCTTATCCTCGAGA
GGGGACGGATATCTTCCAAGAGGGTATATGTCGGGAGTTCACCAACAACC
GTATCCGCACTTGAAGCTCGTTCTCTTGGCTACGAAGTCAGTCTACTTGA
GAGAGTAGAAAAGGAACGGGTGAATACGAAATACTCCTCCTCTTCGGGTT
CCGAGGGCGCACACAAACGACGCCCCCGGAAAGTAGAGCAAGCCGTCGAT
GAAATCCTTCATCTCAAAATTTTAGAGAGTGTTCTGGATTTCACGCCAAC
TACTATCGTGCTAGCCAGCGGTGATGCAGCTCAAGGAGAGTACAGTCCTG
GCTTTTTCAAGGTCGTCGAGAGATGTCTTGATAGGGGTTGGAAAATTGAG
CTGGTATCGTTTAAGGCAAGCTTGAGTTGGCTTTACTCAAACAAGGACTT
CTTAGAGAAGTGGAAGGGAGCCTTTTCGTTAGTCTTGCTAGACACCTTTG
TCGAGGAGCTTTTAGAGTAGCGCACAACCTTTCTCTTACGCTCATATTTC
TCTGCTCATTTCCCACATTCTCCCTCCACTATGTTCAGAGCCTTTTAGCT
CCCCTGCCGCCTTTATTTTTTTGCGCGGTACATCTCTTATAGCTTGTATC
CCTTGCTTCTTTCCTGTTTTTCCATATTTTGTTTTTTTCTGTCT

Sequences in the Contig:

SY0AAB47YC13FM1 SY0AAB9YO24FM1