Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2759
Length(NT) : 1125
Best Gene Model Blast : Link to GSTUMT00002245001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU10077
Accession: ref|XP_957865.1| Score: 200 E_value: 9e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU10077.1 Score: 200 E_value: 4e-14
KOG Definition: No Hit Found
PFAM Definition: SAE2, DNA repair protein SAE2. SAE2 is a protein involved in repairing meiotic and mitotic double-strand breaks in DNA. It has been shown to negatively regulate DNA damage checkpoint signalling..
Pfam Number: pfam08573 Score: 113 E_value: 2e-06

Sequence:
>Contig2759
TTGGGCCAGAAGCCCCGCTATCCTGAGCTAGGAGCGTCGGAGAATATCGG
CAGGCTCGGCTGGATTAGCGGGGGATTTAGAATCGCTCCCACCGGGGATA
CTGGGGAGGCACAGGATGCTGAAAATGATTTGCCAGTACCTATTTTTCCT
CCTTCCGCAGTTGGTGAGGGAAAACCTGTGGGTATATGGCCAGACTCTCA
GTTAGTGCGGCCAACGACCCCAGTGCAAACGGCCGGGGCCGGGCCTAGGA
GCAGCTTTCCAATTTCTGCTGAAAACGAGGGTAGCAAAACACACCCACCT
CTCAGACGATCTAGCCGAACGAGTGCTACTCGAAAGACCCTTTCACCAAC
TACCAAAGCGAAGAAGCTCAATGCCCACTCGCCACCAAAAGCGAAAAAGC
GCCGCATGGCAACATCTAGAGCTATAGCTAGCCTCGCAGAAGATGGTACA
GATGGATGCGAGGACATAAACACCTCTTCCATTCATCCACCGATGGTACT
GTCGGAAAAGCAAAGGAAGCAGCTTGAAAGAGATATGAAAGGCACAACCC
GGTTGGATGATATATTAAATTCGCCTGCATCCCGGACACCAAACTTGGCG
CGTCTTAAGAAGAGTATACAATCTAGAACCTCTCCGGTCAGGAAACGGAC
TTGGGGCGGTGACGGATTCGGGGCACCCCAGGTTCGGCCCCCAAGTAGTG
CTGGCCCGTCTACTTCTGCATGGCGTGCAGGAGGAAATATGAAATCAAAG
GCGCGCGATATAAGTAGTACCTTGGATATTTCTGATTTCCGAGTCAACCC
TGAAGTGAATGATGGCAAAGACTATGCATTCGCAGAAACGGTCAGGAATC
GTGACGCAAGGAAATGCTTACCAGGATGCATGAAGACCTGTTGTAGGGAT
CTTGTTGGCTTCACGGAGGCTGCCGGACTGCCTGCTGTGAGCAAGGGCCC
TAGGTGGAGATCCAGTTCGCCCGCCCCTGTTGACGGTTGTGATCTGCCTA
GGAGGAACCCGAGAAAGGAGTCAGTGAGTAGGGAGGACAAAGCCAAGGAG
TTTACAAATCGGTATGGAAGGCATCGAGATGCATTCGAGAGGCGTAGGAG
CCCACCTGGTTTCTGGGATGCGGAC

Sequences in the Contig:

SY0AAA15YK21FM1 SY0AAA17YM08FM1 SY0AAB39YJ12FM1